How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain
Q: Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the…
A: Sequence assembly involves the alignment and merging of fragments from a DNA (deoxyribonucleic acid)…
Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (???? ?) in newly synthesized…
A: The DNA that makes the genetic material for all prokaryotes and eukaryotes is nothing but a code for…
Q: Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other…
A: The helicase is the protein complexes that are known to separate the DNA strands using the ATP as an…
Q: Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with…
A: Enzyme activity is used to assess the catalytic activity of an enzyme. One enzyme unit (U) is the…
Q: Why are some transposons medically important?
A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…
Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: Yes or no? does rNTP's need to synthesize dsRMA? does rna seq allow to detect of splice…
A: rNTP is ribonucleoside triphosphate which is composed of a ribose sugar, 3 phosphate groups attached…
Q: 4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red…
A: The genetic information always flow from DNA to RNA to proteins. This flow of information is known…
Q: DNA photolyases convert the energy of light in the nearultraviolet or visible region (300– 500 nm)…
A: Ultraviolet Radiations forms a part of electromagnetic spectrum and are categorised according to…
Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…
A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…
Q: rRNA sequence analysis: c. Other than RNA sequence, what other sequence can be determined by this…
A: RNA sequence analysis is used to find the sequence of nucleotide base pairs on the RNA strand.
Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…
A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…
Q: The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs…
A: T7 RNA polymerase shares extensive sequence similarity with mitochondrial and chloroplast RNA…
Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…
A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…
Q: E32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects…
A: This technique is used to determine the sites in the DNA where the proteins are bound. It can be…
Q: How many restrictions sites are present in the EcoRI. Calculate the number of restriction sites for…
A: Restriction endonucleases or restriction enzymes are enzymes that cleave or cut nucleic acids at…
Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (?????) in newly synthesized…
A: transcription is the process by which the dna molecules are converted into messenger rna molecule .
Q: Okazaki fragments in bacterial cells are 1000–2000 nucleotides in length. Those in eukaryotic cells…
A: In the bacterial cell, the length of the Okazaki fragment is 1000-2000 nucleotides, while in…
Q: Which anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one…
A: A codon can be defined as the three-nucleotide sequence present on the DNA or RNA which codes for…
Q: DNA photolyases convert the energy of light in the near-ultraviolet or visible region (300–500 nm)…
A: There are a number of repair mechanisms available in order to modify the errors that occur during…
Q: Q - Can you write one sequence of 15 nucleotides that can be produced using this transformational…
A: In this question, we need to find one sequence of 15 nucleotides from the given transformational…
Q: 4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a…
A: Renaturation is a process of reformation of hydrogen bonds between the complementary single strands…
Q: Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Do DNA ligase has a proofreading activity?
A: BASIC INFORMATION DNA replication requires certain enzymes like : HELICASE - This cuts the two DNA…
Q: Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis…
A: Cordycepin - It is a purine nucleoside antimetabolite.
Q: REPLICATION TRANSCRIPTION TRANSLATION Substrate a) ribonucleotides a) phosphates b) ribonucleotides…
A: Replication is the process of DNA synthesis and to synthesize DNA we require deoxyribonucleotides…
Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…
A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…
Q: 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely…
A: Introduction RNA Interference (RNAi) Is A Biological Mechanism In Which Double-stranded RNA…
Q: 33. Genes for medically important proteins can be cloned and inserted into bacteria, as shown in the…
A: Recombinant DNA is a technique discovered by scientists that allows a human gene to be inserted into…
Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…
A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…
Q: . After Okazaki's proposal of discontinuous DNA chain growth, there was much controversy about…
A: DNA synthesis/replication occurs in 5' to 3' direction on both the strand. The leading strand…
Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical…
A: ANSWER;- Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content =…
Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?
A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…
Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…
A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…
Q: Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP…
A: In genetics, floxing refers to sandwiching the DNA sequence between two lox P sites. Lox P or…
Q: Although aminoacyl-tRNA synhtetases make few errors, occasionally an error. How can these error be…
A: The translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Fill in the gaps? One major goal/motivation in the development of synthetic genomes is ...... .…
A: In some ways, synthetic biology is similar to genome editing as both involve changes in the genetic…
Q: PRDM9 recruits SPO11, a topoisomerase type II like protein, to induce DNA double strand breaks.…
A: Introduction PRDM9 is a DNA binding and zinc finger protein that trimethylates histone H3K4…
Q: Yes or no? Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization?…
A: Riboprobe are the synthetically made piece of RNA that will bind to target gene. And will be used in…
Q: Will restriction sites for an enzyme that has 4 bp in its recognition sequence be closer together,…
A: A restriction site is a DNA sequence that binds to a given restriction enzyme
Q: describe the normal role of the component, and choose from the selection the most direct effect of…
A: Introduction :- DNA is the genetic material of the cell . It stores all the hereditary information (…
Q: Mutation: Thiamine Dimers A. what is a mutagen or cellular process that leads to this mutation? B.…
A: DNA damage occurs either due to mutation or error that occurs during the processing of DNA such as…
Q: HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence…
A: Restriction enzymes are the molecular scissors and are used to cut at a specific site. These are…
Q: Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a…
A: The average weight of a single DNA bp is 650 daltons. This can also be represented as 650 g/mol (=…
Q: Draw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why…
A: Frederick Sanger developed the chain termination method to determine the sequence of nucleotides in…
Q: Many of the gene products involved in DNA synthesis wereinitially defined by studying mutant E. coli…
A: DnaE gene is involved in the formation of phosphodiester bond between nucleotides, whereas DnaQ gene…
Q: Suppose that you want to assay reverse transcriptase activity. If polyriboadenylate is the template…
A: A reverse transcriptase (RT) is defined as an enzyme that is used to generate complementary DNA…
Q: the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: DNA polymerase is the main enzyme for replication that is it synthesizes complementary strand…
How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Compare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features: (a) activated precursors,(b) direction of chain elongation, (c) conservation of the template, and(d) need for a primer.Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
- Explain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and T4 DNA ligase.Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.A researcher has isolated a restriction endonuclease that cleaves at only one particular 10- basepair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain.
- Please help witht this homework question A- What are the topological parameters (linking number, twist, and writhe)for a relaxed, 4,200 base pair circular double-stranded DNA plasmid? LK=? Tw= ? Wr=? The CRISPR-Cas9 protein first forms a protein-RNA complex with a guide RNA, and then binds to DNA sequences that match a 20-base target sequence within the guide. When the CRISPR-Cas9 complex binds to DNA, it unwinds about 20 base pairs of the DNA double helix. B- Why is DNA unwinding required for CRISPR-Cas9 protein-RNA complexto recognize target sites? C-How would the topological parameters (linking number, twist, andwrithe) of the 4,200 bp plasmid in (A) change when the CRISPR-Cas9 complex binds the DNA and unwinds about 20 bp? Lk=? Tw=? Wr=? D- What is the linking number after the CRISPR-Cas9 complex cleaves theDNA?Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit the binding of σ factor to the DNA. Describe two specific base substitutions you think would inhibit the binding of σ factor. Explain why your base substitutions would have this effect.Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.
- A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). Solve, (b) Determine the amino acid sequence of each peptide.Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…