Mutation: Thiamine Dimers A. what is a mutagen or cellular process that leads to this mutation? B. If the nucleotide excision repair pathway is not functional, is there another pathway or mechanism for preparing this mutation? if so, what is the pathway/mechanism? C. what is the consequence of this mutation if it is not repaired before DNA is replicated to make the next generation of cells?

Q: Define a mutation. Are they good or bad?    What types of mutations can occur in the DNA?    What…

A: A permanent modification in the DNA sequence that makes up a gene, such that the sequence differs…

Q: reduction in histone acetylation and reduced gene transcription. Given this information, which of…

A: Transcription is a highly controlled process and it requires the presence of enzymes polymerase and…

Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…

A: DNA ligase is the enzyme connecting two DNA strands together. It does so by bonding the phosphate…

Q: Find a drug that is currently used in cancer treatment Tell me what it is used for (e.g. any…

A: There are many drugs that can be used to treat cancer which has action of targeting DNA…

Q: primase The enzyme synthesizes the RNA primers required for DNA replication. Why are the RNA primers…

A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…

Q: Please explain the full DNA synthesis process

A: DNA synthesis occurs when a cell divides,  in the process known as replication. DNA replication is…

Q: kept apart b As helicase unwinds the DNA molecule, the separated strands are Topoisomerase True…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: a) Under normal conditions E. coli produces three DNA polymerases. State their functional…

A: E.coli bacteria are considered prokaryotes, and the prokaryotes exhibit three different types of DNA…

Q: Explain how the molecular mechanism of DNA polymerase enhances DNA replication.

A: Introduction - The replication of a double-stranded DNA molecule produces two identical DNA…

Q: Contrast the various types of DNA repair mechanisms known to counteract the effects of UV radiation.…

A: A variation is an adjustment in a DNA grouping. Changes can result from DNA duplicating botches made…

Q: 5. The pioneering work of Paul Berg, Herbert Boyer, and Stanley Cohen in the early 1970s led to the…

A: Insulin, a peptide hormone produced by the β-cells of the pancreas and is a regulatory hormone for…

Q: Explain the process of DNA elongation. In your discussion, make sure you discuss the direction of…

A: Basically, elongation is the stage when the RNA strand gets longer, thanks to the addition of new…

Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?

A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…

Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…

A: The relaxed DNA is a type of conformation, which moves slowly in the gel of electrophoresis. The…

Q: Smoking status is a known risk factor for lung cancer development. Researchers are conducting a…

A:

Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…

A: Mutations are changes that occur in the nucleotide sequence of DNA. The mutations can be somatic,…

Q: Patients, who have a defect in one of the DNA repair systems may have what? Check All That Apply A.…

A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA…

Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…

A: According to the central dogma, the most common pattern of information in our cells is: From…

Q: Describe how this type of DNA repair works

A: DNA damage is caused due to chemical addition or deletion of a base of DNA which create an abnormal…

Q: 9. Using your knowledge of DNA repair pathways, choose the pathway that would be used to repair the…

A: DNA repair pathways are a set of processes by which cell defines and corrects the damage to DNA that…

Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…

A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'

Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…

A: DNA is two stranded structure which make it own strand via  replication process . It comprises of…

Q: DNA repair is an important mechanism that protects the genetic material from damage. While working…

A: UV radiation is one of the most widely recognized ecological wellbeing perils that cause…

Q: Hereditary nonpolyposis colon cancer (HNPCC) is caused by mutations in proteins from one of the DNA…

A: HNPCC is an autosomal dominant inheritance that causes colon cancer in humans. this mutation is…

Q: Elaborate repair mechanisms that prevent permanent mutations in DNA are associated with replication,…

A: DNA is the genetic material an is double stranded. The template strand of DNA transcribes mRNA by…

Q: 1.Photoreactivation is called a direct reversal of DNA damage. Mismatch repair, Nucleotide excision…

A: The presence of mutation in the genome gives rise to genetic variations. These variations are…

Q: Knowing that DNA cloning means making multiple identical copies (clones) of a DNA sequence of…

A: Clones are identical copies to their parents. A clone can be an organism clone or a cell clone.…

Q: Mustard gas is an extremely toxic substance that severelydamages lung tissue when inhaled in large…

A: Sulfur mustard induces chromosome aberrations-gross structure breaks visible under light in a…

Q: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial…

A: # According to our guidelines we can answer only first 3 subparts or in case of short type questions…

Q: a. Propose three different mutations to prevent initiation, elongation, and termination of bacterial…

A: Mutations: Mutations are caused due to alterations in the DNA sequence possibly affecting its…

Q: In your own words, explain how cancer cells differ from normal cells in regard to the following:…

A: The ends of a chromosome are known as telomeres. These are regions that do not code for the DNA in…

Q: Faulty DNA repair; ii) Gain-of-function; and iii) Trinucleotide repeats  provide genetics disorders…

A: Asked : Example of mutation are asked with disorder for given condition.

Q: After Heat the mixture to separate mRNA and cDNA strands, and then eliminate the mRNA transcript.…

A: cDNA (complementary deoxyribonucleic acid) is a synthetic nucleic acid molecule synthesized in-vitro…

Q: Which of the following types of mutations are advantageous to cancer cell growth? a. Those…

A: DNA is the genetic material present in the genome of organisms.

Q: True or false?  DNA repair mechanisms all depend on the existence of two copies of the genetic…

A: RNA polymerase is an enzyme that converts a DNA sequence into an RNA sequence via the transcription…

Q: Muscle cells and neurons have the exact same DNA, however, they look very different and perform…

A: DNA or Deoxyribonucleic acid is a molecule which comprises of two polynucleotide chains that wound…

Q: Briefly explain the significance of telomerase in normal cells versus tumors and cancer cells

A: In promulgating progenitor cells deduced from labile normal stem cells as well as in embryonic stem…

Q: 5'--TTAATGGGACAGCTTGTGTAGAGG--3' a.) What is the complementary strand of DNA? b.) What is the…

A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid and Deoxyribonucleic…

Q: Cancer cells must be able to proliferate indefinitely. Therefore, many inappropriately express…

A: Cancer cells are cells that divide relentlessly, forming solid tumors, or flooding the blood with…

Q: describe the normal role of the component, and choose from the selection the most direct effect of…

A: Introduction :- DNA is synthesized through the process of DNA replication, during the S phase of…

Q: Nucleotide excision repair   A. recognizes and repairs thymine dimers and other damaged bases in…

A: It is an important excision mechanism that removes DNA damage induced by ultraviolet light.

Q: A certain mutant DNA polymerase is error-prone, tending to incorporate C opposite a template A. When…

A: Mutations in the DNA polymerase would affect the process of replication. It is studied under the…

Q: a. Consider an ideal scanning electron microscope (neglect all aberrations and electron-sample…

A: Given, Ideal electron microscope 1) wavelength of electron operating at 2kV is 0.0274pm. 2)…

Q: He follówing diagram of how protein AWESOME1 binds to it's target DNA, al effects of each of the 5…

A: A mutation is a permanent change in the nucleotide sequence of DNA that can occur during replication…

Q: 3A. Were the effects of this mutation, beneficial, harmful, or neutral? Justify your position based…

A: Answer: Mutation = These are the changes occured in the nucleotide sequence of a DNA which can be…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.