Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.
Q: Sort the size (bp) of DNA fragments on this gel from small to large. 1 smallest and 4 = largest. B
A: Electrophoresis is the method in which the dispersed particles show motion that is related to the…
Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…
A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…
A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…
Q: Contrast the processes used by bacterial cells and eukaryotic cells to package their DNA.
A: Asked : Processes used by bacterial cells and eukaryotic cells to package their DNA
Q: Define the reason why when a dideoxyribonucleotide is incorporated into a newly made strand the the…
A: The Sanger chain termination sequencing method was invented by Sanger to identify the sequence of…
Q: Identify the template and non-template strand on the DNA. B TACGGATACG UACGGAUA ATGCCTATGC
A:
Q: . Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…
A: The central dogma of molecular biology describes the flow of genetic information in the cell from…
Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…
A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…
Q: Draw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this…
A: Deoxyribonucleic (DNA) acid is a double helix structure, which is composed of nucleotides joined by…
Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'
A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: What feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the…
A: Introduction: Gel electrophoresis is a molecular technology that helps to separate the DNA fragments…
Q: Draw a short segment of a single polynucleotide strand, including at least three nucleotides.…
A: A nucleotide has three components namely,(a) A nitrogenous base.(b) A pentose sugar (ribose in case…
Q: Label the 5' and 3' end of each nucleotide and approximate where the start point (+1) would be on…
A: The process shown here is called transcription. In this process a molecule of mRNA is synthesized…
Q: Illustrate how the glycosyl-bond of the base results in left-handed DNA.
A: Left handed DNA is also called Z-DNA. The Z-DNA contain glycosidic bond.
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: strand: (d) Specify the anticodon present on each of the transfer RNA's involved.
A: Deoxyribonucleic Acid (DNA) is a two-stranded biomolecule. It is a build-up of nucleotides. Distinct…
Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…
A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…
Q: Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.
A: Introduction: DNA stands for deoxyribonucleic acid and is a form of nucleic acid. Except for a few…
Q: Write a double-stranded DNA sequence that is 20 base pairs inlength and is palindromic.
A: The palindromic sequence refers to the type of sequence in which the sequence is same on each strand…
Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: Write the complementary sequence of DNA AGCTAT AGC
A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…
A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…
Q: Answer the above question for CutVI if the starting DNA were linear instead of circular.
A: Restriction enzymes are enzymes that identify specific sequences in DNA and cut DNA at or near these…
Q: Write the sequence of the DNA strand complementary to the following strand:…
A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…
Q: Explain why it is necessary that DNA is replicated continuously on the leading strand by but…
A: Introduction : Direction of DNA replication is 5' - 3' . Primase add primer and DNA polymerase…
Q: Diagram how replication slippage changes an STR with 4 repeats into an STR with 5 repeats. The STR…
A: introduction A short tandem repeat is a microsatellite with repeat units that are 2 to 7 base pairs…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…
Q: Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding…
A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'
Q: A student was analyzing the base composition of a DNA sample, but has lost all the data except the…
A: DNA nucleotide base structure: Each individual unit of the DNA nucleotides is made up of a…
Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.
A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…
Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…
A: They enhance the rate of a reaction without being consumed or modified during the reaction.…
Q: Type the matching bases below in each DNA sequences. A T T C G A C G T C
A: DNA sequence composed of a row of chemical building blocks - called "bases". There are four types of…
Q: Explain how the chemical structure ofdeoxynucleotides determines the orientation of theDNA strands…
A: Two polynucleotide chains that coil around each other to form a double helix are called DNA or…
Q: Explain why H is 5' and leading strand and E is 3' and laggin strand
A: Nucleic acid serves two major functions: carrying genetic information and messenger to relay the…
Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB
A:
Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…
A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…
Q: Write the base sequence in a complementary DNA segment if each original segment has the following…
A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…
Q: Determine what amino acid will be formed from the given DNA strand below:…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…
Q: Explain what is meant by the antiparallel polarity of the two strands of DNA within the double…
A: Double helix can be defined as the structure of a DNA molecule. The DNA molecule consists of two…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…
Q: Identify the level of DNA structure associated with the sequence of nucleotides. tertiary secondary…
A: Answer:- The correct answer for this question is Primary structure. The nucleotides which when…
Q: Complete the complement strand of DNA by providing the correct base pairs. Template Strand:…
A: DNA: The DNA molecule of all known animals and many viruses contain genetic instructions in the…
Q: Translate the following opposite strand of DNA based on the nucleotide bases. ATTGACTGG
A: The genetic code is a series of three-letter nucleotide combinations called codons, each…
Q: Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced:…
A: From the DNA sequence the mRNA is produced within the nucleus of the cell by the transcription…
Q: If the length of E.coli DNA is 1.36 mm, calculate the number of base pairs it contains
A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic information for an…
Q: #1: 3’ T A C A T G C C G A A T G C C 5’ #2: 3' T A C T…
A: The mRNA is produced from the DNA by the process of transcription and proteins are produced from the…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
Step by step
Solved in 2 steps with 1 images
- You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage l genome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.
- The restriction endonuclease PstI cuts DNA symmetrically on both strands at the sequence: CTGCAG GACGTC On the resulting DNA fragments are left 3’ overhanging ends of 4 nucleotides. PstI cleavesthe phosphodiester backbone with a-type specificity. In short-hand notation, showing theidentity of phosphates on the ends, draw the two fragments that result from PstI digestion ofthe following double-strand ed oligonucleotide: 5’-pAATTGCTACTGCAGAACCGG-3’ 3’-TTAACGATGACGTCTTGGCCp-5’Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
- Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name Recognition sequence and position of cut 5'GIAATTC3 5'G!GATCC3' 5'GIGTACC3 5'GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3 EcoRI ВатHI Аcс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given aboveGiven the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post here
- The partial sequence of one strand of a double-stranded DNA molecule is 5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG -3' EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after A in the sequence 5'-CTGCAG-3'. Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first strand of your duplex DNA fragment should be derived from the given strand sequence. 5'- -3' 3'- -5'All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.