Q: Molecular biology, please explain in detail
A: During the entire migration process, cells could be observed. It was possible to determine the…
Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…
A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid ) is a…
Q: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST…
A: Amino acyl tRNA synthase functions to join appropriate amino acids with their corresponding tRNA.…
Q: Give the similarities and differences of Genomics from Bioinformatics, and Proteomics from…
A: Transcriptomics is defined as the techniques that are utilized for studying and knowing an…
Q: Gene ________ varies considerably within a genome,reflecting differences in intron size and in the…
A: A gene is a sequence of DNA nucleotides that encodes a protein. A genome of an organism includes all…
Q: Explain the "central dogma" of DNA-protein synthesis and DRAW it, including labels for replication,…
A: Central dogma: The production of proteins from the DNA is known as central dogma. It involves mainly…
Q: Compare and contrast the roles of introns and exons.
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: studies both the gene transcription and translation products and its modified form of proteins O…
A: Transcription and translation are part of central dogma which ultimate leads to production of…
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Translation is the process by which proteins are synthesized by joining of amino acid using mRNA and…
Q: C 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…
A: DNA is ladder like , two strand structure that act as genetic material in most of Organism.…
Q: describe genetic screen
A:
Q: Briefl y describe the events in translation.
A: Translation is the process of formation of protein from the information containing in mRNA. It is…
Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…
A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…
Q: Draw primary RNA transcript and mRNA. label any modifications that have been made in the structure,…
A: The given sequence is of the dna.this is the coding strand of the template and this consist of…
Q: Discuss the significance of protein sequencing.
A: Protein sequencing is a process of determining the sequence of amino acids of a protein.
Q: ) With the indication of sense strand, template strand, the direction of transcription, provide a…
A: the direction of the DNA template strand for transcription is Strand elongation DNA is…
Q: Describe the process of RNA editing.
A: Post-transcriptional modification or co-transcriptional modification is a series of biological…
Q: RNA has many functions in a cell. Besides mRNA, which carries information from the genome to the…
A: RNA is a nucleic acid which is present in all living cells. It has structural similarities to DNA…
Q: In details summarize the process of Translation and post translation process.
A: Translation: Nucleotide language is transfer to language of amino acids. In short mRNA language is…
Q: Explain how rRNA is processed.
A: Ribosome biogenesis or the assembly of ribosomes involves more than 200 assembly factors and spreads…
Q: Identify if the statement is correct or incorrect, "rRNA serves as template for the synthesis of…
A: During translation, protein is formed. A segment of DNA carries the code required for specific…
Q: Explain how tRNA is activated, including the role of a specifictRNA activating enzyme, ATP and amino…
A: The different types of tRNA is identified by a specific TRNA activating enzyme. The molecule of tRNA…
Q: Explain how the DNA code may be copied, and describe the basicfunctions of RNA.
A: The basic process of copying DNA is called DNA replication. DNA is copied and a new molecule of DNA…
Q: Differentiate between a genomic library and a cDNA library
A: Genome refers to the total genetic content of an organism. It includes chromosomal DNA as well as…
Q: Compare transcription to translation. Which of the process is mostly related to errors?
A: Transcription vs Translation Initiation- The transcription process is the beginning of the gene…
Q: How to transfer biological information in protein synthesis? What is the link between DNA and…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
A: Definition: CRISPR: A segment of DNA compiled of short repetitions of base…
Q: 17. Differentiate genomics, transcriptomics, proteomics, metabolomics and bioinformatics.
A: Omic (omics) technologies are used to aimed at universal detection of genes (Genomics), mRNA…
Q: Molecule Structure, Function diagram or description TRNA Ribosome MRNA poly-a tail
A: Transcription is the process of synthesis of RNA from DNA, using DNA as a template. It is initiated…
Q: Explain The Central Dogma of Molecular Biology, highlighting the process of protein synthesis.
A:
Q: Using a diagram, outline the structure of a ribosome, including protein and RNA composition, large…
A: Ribosomes are sphere shaped structures located within the cytoplasm of a cell. They remain free in…
Q: Briefly describe the events in translation.
A: The translation is one of the defined processes of the cell cycle. It is the last step in fact and…
Q: directly relates to its function. Which statement describes the relationship between the structure…
A:
Q: B. Write a paragraph on the importance of DNA availability and the impact it has on Protein…
A: DNA is deoxyribonucleic acid (genetic material) found in all living cells. In prokaryotes, it is…
Q: d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide…
A: we are answering D part E part is missing pls repost for E part.
Q: A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following…
A: The above given statement is about protein and amino acids and their codons.
Q: Describe how rRNA and tRNA are being processed.
A: tRNA and rRNA are structural molecules, they help in protein synthesis and they are not themselves…
Q: Complete the DNA and RNA sequencing for the translation and creation of proteins
A: The sequence of DNA RNA are used to create amino acids which in turn code for proteins.
Q: explain how the concentration of the N protein helps regulate the transcription of mRNA and full…
A: Viruses are microscopic living things found in a variety of habitats on earth. Mostly all the…
Q: Relate tRNA’s structure to its function
A: tRNA refers to transfer RNA is a small molecule which contain 74 to 95 ribonucleotides. They are…
Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?
A: CAT CTA CAA ATA GCA CCT AAT TGT G (DNA)
Q: Identify the features of tRNA that are important in decoding genetic information and converting it…
A: Codons encode specific amino acids for protein synthesis, a process known as translation. Transfer…
Q: Describe the process of ribosome synthesis in a bacterial cell by including each level of…
A: Three Main Types of RNA-Messenger RNA (mRNA) - Carries copies of instructions for the assembly of…
Q: The process of gene transcription begins with the joining of rRNA with various ribosomal proteins.…
A: The method of copying a part of DNA into RNA is referred to as transcription. DNA fragments…
Q: In nucleic acid Differentiate: gene, genome and gene expression
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: Different types of mutations and how to use the genetic code table.
A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…
Q: For the p53 gene, create a summary with a proteomics focus. You can include protein domains, protein…
A: p53 gene: It is also known as TP53 or tumor protein . It is a gene that makes a protein that is…
rRNA sequence analysis:
c. Other than RNA sequence, what other sequence can be determined by this method?
Step by step
Solved in 3 steps
- rRNA sequence analysis:b. Briefly describe why rRNA sequence helps determine relatedness.Describe the process of transcribing DNA into mRNA. Be sure to also include the following key terms: editing, RNA polymerase, gene, base pairs, nucleus, transcription factors.Gene Expression: Illustrate some steps involved in RNA processing and identify the sequence of amino acids in a polypeptide chain corresponding to the codons in the mRNA. Procedure and Questions: The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. 1. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2. Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends. 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide
- A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 LC. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
- a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is generated and regulated. Indicate the direction of synthesis. b. Synthesize a polypeptide from the mRNA.generated after a cDNA library is made unique sequences in the genome useful for mapping using sequence information all of the aboveNeed help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?