replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a change in the base sequence of a length of DNA may affect the structure and function of the protein encoded by this gene

replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a change in the base sequence of a length of DNA may affect the structure and function of the protein encoded by this gene

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Related questions

Q: The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare…

A: Introduction The biological process of producing two identical copies of DNA from a single original…

Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…

A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…

Q: Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and…

A: A pairs with T with2 hydrogen bonds and C pairs with G with 3 hydrogen bonds.

Q: Is it unusual that the -subunits of DNA polymerase III that form a sliding clamp along the DNA do…

A: Replication of DNA is catalyzed by a DNA polymerase enzyme. There are many types of DNA polymerases…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: c.) ( between turns, glycosidic bond conformation and sugar conformation differs between A-form DNA…

A: DNA, is basically called deoxyribonucleic acid, is the hereditary material in humans and almost all…

Q: List and describe the function of the ten subunits constituting DNA polymerase III. Distinguish…

A: Introduction DNA pol III is the primary enzyme which leads the DNA replication system. It is a…

Q: Which Strict Operating Requirements DNA Polymerase Has?

A: DNA polymerase is an enzyme involved in the synthesis of nucleotides. These are important for the…

Q: ⦁ Original: ATTTGAGCC Mutated: ATTGAGCC. This is an example of what kind of mutation?

A: The alteration, damage, or change in the gene of DNA occurs which can change the genetic information…

Q: Why does replication process struggle with repetitive sequence - and how does this impact a certain…

A: Genomes containing lots of repetitive sequences like the human genome create difficulties with…

Q: Replication of a circular DNA molecule can occur by either theta replication or by rolling circle…

A: DNA replication is a process that occurs in all living organisms. In this process, DNA strands of…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: Escherichia coli (E. coli) has one replication origin that contains specific genomic sequences…

A: DNA replication It is defined as the process through which the copying of DNA takes place in cells.…

Q: Describe the Okazaki fragment and its formation in one of the strands of DNA essentiality of their…

A: Only while each strand of DNA is separated from an additional can DNA polymerase activity continue…

Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”

A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…

Q: Huntington's disease in regards to Trinucleotide repeats give detailed reponses provide exmaples

A: Huntington's disease(HD) is caused due to mutation in the HD gene where the trinucleotide…

Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......

A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…

Q: With regard to DNA replication, define the term bidirectional replication.

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and…

A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…

Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…

A: DNA polymerase is an enzyme involved in the synthesis of DNA molecules by joining the dNTPs…

Q: Is it unusual that the β-subunits of DNA polymerase III that form a sliding clamp along the DNA do…

A: DNA pol II is the primary enzyme involved in DNA replication. It is a mutiprotein complex that…

Q: Describe the synthesis of the leading strand during DNA replication. Assume the replication bubble…

Q: In E. coli, RecBCD complex has (select all correct answers) endonuclease activity а. O b. DNA…

A: RecBCD is a enzyme of e.coli which is required to repair thier DNA. RecBCD has many components and…

Q: Explain why DNA replication requires RNA primers. What do they do and why do they have to be…

A: The process of duplicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…

A: According to the central dogma, the most common pattern of information in our cells is: From…

Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…

A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…

Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”

A: Substitution is a type of genetic mutation in which there are three possibilities after the…

Q: Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand…

A: All DNA strands are made up of nucleotides namely Adenine (A), Thymine (T), Guanine (G), and…

Q: Explain the mechanism of trinucleotide repeat expansion.

A: Introduction: A trinucleotide repeat expansion is type of DNA mutation. In which, the trinucleotide…

Q: In E. coli, all newly synthesized DNA appears to be fragmented (an observation that could be…

A: Uracil-DNA glycosylase is an enzyme that helps to prevent the mutagenesis process through the…

Q: a) Complete the table below. Assume that reading is from left to right and that the columns…

A: In molecular biology central dogma is the mechanism which takes place from the DNA(hereditary unit…

Q: Briefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear…

A: Hello, thank you for your question. Since you have posted multiple questions. I am solving the first…

Q: DNA polymerases cannot initiate DNA synthesis without a primer, a section of nucleic acid having a…

A: Primase is an RNA polymerase which produce short strand of primer required by DNA polymerase in DNA…

Q: pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA…

A: DNA (deoxyribonucleic acid), as well as RNA (ribonucleic acid) both, are the genetic material in the…

Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…

A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…

Q: Single-strand binding proteins keep the two parental strands of DNA separated from each other until…

A: Deoxyribonucleic acid or DNA is the genetic material that is passed on from the parents to the…

Q: Background: DNA nucleotides (i.e A, T, G, and C) are naturally found in a paired, or bonded,…

A: Central Dogma: This illustrates the flow of genetic information from DNA to RNA to protein. This…

Q: Telomerase adds six deoxynucleotides to the end of a DNA strand using a built-in RNA template.…

A: The ends of eukaryotic chromosomes are called telomeres, and they are composed of repeats of a…

Q: True or false: During DNA replication, the DNA template is read 3 ́ to 5 ́ by a DNA polymerase, as…

A: DNA replication is a biological process in which two identical copies of DNA are formed during cell…

Q: Define and indicate the significance of (a) Okazaki fragments,(b) DNA ligase, and (c) primer RNA…

A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…

Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…

A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: Draw the structures of two tautomeric forms of guanine, one a lactam, the other a lactim. Explain…

A: Guanine is one of the four principle nucleobases found in nucleic acids namely DNA and RNA. The…

Q: Digestion of a DNA sample with Decll, which is a “4-cutter" enzyme that produces blunt (rather than…

A: A 4-cutter restriction enzyme means the recognition sequence of the enzyme is a 4 bp sequence. It…

Concept explainers

Substance Abuse

Substance abuse refers to the use of illegal drugs in excessive quantities, as well as the misuse of legal substances such as prescription or over-the-counter pharmaceuticals or alcohol for purposes other than those intended. Drug addiction, also known as substance use disorder, is a disease that affects the brain and behavior of a person. It leads to a failure to control the use of any drug or prescription, legal or illegal.

Question

100%

Many thanks

replication, resulting in a
(e) Errors may
change to the sequence of base triplets. Explain how a
change in the base sequence of a length of DNA may
affect the structure and function of the protein encoded by
this gene.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?
Replication of a circular DNA molecule can occur by either theta () replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe differences between the two approaches to replication - an accurate statement about one form of replication that does not clearly indicate how the other form differs is not a correct)
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA, polymer, -ase) makes sense.
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA molecule allowthis distinctive structure to form?
Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids adopt the structure of A-DNA. Considering thestructural differences between DNA and RNA, explain thisphenomenon.
A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.