Q: If the 5’ splice site sequences changed from 5’GUAAGU 3’ to 5’ GUAUGU 3’, predict the effect of the…
A: RNA produced during transcriptional process containing introns are known as heterogeneous nuclear…
Q: elomere position effect (TPE) alters the gene expression in yeast cells? why?
A: Transcription and replication of adjacent DNA is affected by telomere.telomeres also impose an edge…
Q: Some prion-related diseases, such as familial fatal insomnia, areinherited. How would you expect the…
A: Familial fatal insomnia is a medical condition characterized by insomnia or trouble sleeping. This…
Q: What functional information about a genome can be determined through applications of chromatin…
A: Chromatin Immunoprecipitation (ChIP) is a type of technique based on immunoprecipitation and is…
Q: Using Remdesivir against Covid-19 Kokic, Goran, et al. (2021) have shown the mechanism of Remdesivir…
A: Abstract Background & aims: Remdesivir is a broad spectrum anti-viral drug that has shown to…
Q: How do eukaryotic and prokaryotic RNA polymerases compare? Despite their added complexity,…
A: The general process of transcription can be applied to both prokaryotic cells and eukaryotic cells.…
Q: What molecular biology strategy can best be used to determine Inhibition of the splicing of one…
A: In eukaryotic genes, introns exist. They are interstitial sequences (80-10,000 bp). They do not code…
Q: Remdesivir is a prodrug and not a substrate for the nsp12 polymerase. Why must remdesivir be…
A: Ramdesivir is a wide spectrum anti-viral nucleoside analogue drug which recently came into limelight…
Q: In your own words, explain the term transposon tagging.
A: Transposons or jumping genes are the sequences of DNA that are able to change their position within…
Q: Why do trans-sRNAs often require a chaperone protein?
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Compare and contrast Retroposon & Transposon. What makes them similar, what makes them different?
A: Jumping genes or mobile DNA elements are also referred to as short DNA sequences that are able to…
Q: Prokaryotic mRNAs are polycistronic such that ribosomescan translate several different polypeptides…
A: A monocistronic mRNA is defined as a messenger RNA (mRNA) that encodes one protein. The eukaryotic…
Q: If all members of a transposable element family can besilenced by dsRNA synthesized from a single…
A: nematode cells are infected with short double-stranded RNA (dsRNA) segments (Caenorhabditis…
Q: 1. Ribosomes are “ribonucleoprotein particles” in that they are composed mostly of rRNA with some…
A: All live cells require ribonucleoprotein particles, which include both RNA and proteins. They…
Q: How do eukaryotic and prokaryotic RNA polymerases compare? Eukaryotic and prokaryotic RNA…
A: Prokaryotes have only one RNA Polymerase, while eukaryotes have three (RNA Polymerases I, which…
Q: The PIC is highly conserved among species, from yeast to humans. Why is the positioning of the first…
A: PIC stands for the pre-initiation complex. The core promoter region comprising of the initiator…
Q: Define `transcriptome'. Briefly describe the genome tiling array technology to `visualize'…
A: Hi dear, here's your answer what you want.can you please give me a like for this answer. * Every one…
Q: transduction.2. Explain how each of these three methods of genetransfer can be used to map bacterial…
A: The three methods or mechanisms of gene transfer in bacteria are: Transformation, Conjugation, and…
Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…
A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…
Q: Mutants of S. pyogenes Cas9 have been developed which recognize different PAM sequences, such as 5′…
A: A short DNA sequence, the protospacer adjacent motif (PAM), is often accustomed to mark correct…
Q: In which direction along the template must theRNA polymerase in Figure Q6–1 be moving to have…
A: Throughout transcription, the RNA polymerase proceeds along the template strand in a 5'-3'…
Q: Given that ncRNA can have separate protein interaction sequences and nucleotide interaction…
A: ncRNA (non-coding ribonucleic acid) refers to the RNA molecule which is formed by the transcription…
Q: Question: how does the flu without the track arise and what does it mean male type splicing if the…
A: Flu first arrise from birds and animals then it transmitted into humans. It's spread from virus.…
Q: What would you expect krox20 expression to look like in embryos treated with an RA inhibitor? Why?…
A: krox20 is also known as early growth response protein 2, it is a transcription regulatory factor.it…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: Introduction Termination of transcription: It involves the termination of RNA chain synthesis by…
Q: BIOLOGICAL IMPLICATIONS OF CRISPR-CAS9
A: Cells are the littlest units of life, and subsequently are regularly alluded to as the "building…
Q: This chapter describes different types of TEs, including insertionelements, simple transposons, LTR…
A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…
Q: In vitro translation systems have been developed inwhich specific RNA molecules can be added to a…
A: DNA (deoxyribonucleic acid) is first transcribed to form mRNA (messenger ribonucleic acid) which is…
Q: Briefly describe paramutation at the Kit locus in mice. What evidence suggests that small RNA…
A: Allele is any one of two or more genes that may occur alternatively at a given site (locus) on a…
Q: How often would the conserved sequence upstream of the 3' splice site, CURAY (R= PURINE, Y=…
A: There are a total of four different ribonucleotide bases in the RNA (ribonucleic acid). The…
Q: Yes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in…
A: Rna seq can provide sequence and expression data : YES Single-cell RNA sequencing (scRNA-Seq)…
Q: protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the…
A: CRISPR technology is a simple yet powerful tool for editing genomes. It allows researchers to easily…
Q: Using ClustalOmega (available here), compare the nucleotide sequence of the regulatory region for…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by errors…
Q: Is it possible to determine the number of original transcripts in an RNAseq sample if 15 copies of…
A: Yes, it is possible to measure the number of original transcripts in an RNA seq sample.
Q: In eukaryotes, transcription initiation involves enhancersequences located far from the promoter. In…
A: Eukaryotic transcription is the lengthy process that eukaryotic cell uses to copy genetic…
Q: PRDM9 recruits SPO11, a topoisomerase type II like protein, to induce DNA double strand breaks.…
A: Introduction PRDM9 is a DNA binding and zinc finger protein that trimethylates histone H3K4…
Q: Keeping in mind the three main processing events that occur in eukaryotes (5' capping, 3' cleavage…
A: An RNA (ribonucleic acid) is formed by the process of transcription from DNA. During transcription…
Q: Protein expression: Given that we control the composition of the medium in which we grow our…
A: Genetic engineering is the branch of biological sciences which deals with making manipulation in the…
Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene.…
A: A gene is the basic structural and functional unit of heredity. They are made up of DNA.
Q: . All mutations that abolish function of the Rho termination protein in E. coli are conditional…
A: Rho factors are the type of proteins present in prokaryotes that are responsible for transcription…
Q: DNA supercoiling, which occurs when coiling tension is generated ahead of the replication fork, is…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: . In many bacterial species, regulatory sRNAs havebeen identified by transcriptome sequencing…
A: Once the whole RNA is extracted and cDNA is synthesized, the cDNA is then sent for sequencing. Once…
Q: _snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These…
A: Splicing is a process that removes non coding sequence of genes from pre mRNA. Non coding sequence…
Q: Create a hybrid cDNA-mRNA molecule using reverse transcriptase and oligo-dT primer, what is step 3…
A: Deoxyribonucleic acid (DNA) is a genetic material containing thousands of genes which code for…
Q: Suppose the following are sequences at the 5' splice junction and the 3' splice junction, with…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: The amino acid sequences in the lysozyme protein produced by the TF phage were studied by…
A: Translation is a process in which single stranded mRNA act as template for the manufacturing of…
Q: Suppose that you want to assay reverse transcriptase activity. If polyriboadenylate is the template…
A: A reverse transcriptase (RT) is defined as an enzyme that is used to generate complementary DNA…
Q: Is RNA polymerase saturated with substrates in vivo? Describe experiments that might indicate…
A: RNA polymerase is an enzyme involved in the process of transcription and is responsible for binding…
Yes or no?
does rNTP's need to synthesize dsRMA?
does rna seq allow to detect of splice variants
Step by step
Solved in 2 steps
- What is the difference between crRNA and tracrRNA? Why are both needed for Cas9 to function? What does PAM stand for? Where is it found? What is the difference between Non-homologous End Joining (NHEJ) and Homology Directed Repair (HDR)?Is it possible to determine the number of original transcripts in an RNAseq sample if 15 copies of a specific transcript are seen. If yes how, if no, then whyGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
- . One way to determine where inside a cell a protein(protein X) normally localizes is to generate a reportergene construct containing: (i) the gene X regulatoryregion and coding sequences, and (ii) coding sequencesfor GFP fused in frame to the 3′ end of the gene Xcoding sequences just before the stop codon. A mousecontaining such a transgene will express a hybrid protein X-GFP only in those cells in which gene X is normally expressed.a. The gene X-GFP fusion gene described could begenerated by knocking in GFP coding sequencesinstead of by random insertion of a transgene.Diagram the knockin construct you could use forthis purpose.b. What might the advantage be of the knockin strategy versus the transgene strategy?explain please: Spike-Driven Syncytia Formation Is Coupled to S20 Fragment Generation in the Presence of ACE2. To investigate the functional and biochemical signatures of spike (S) protein upon engaging its receptor ACE2 in live cells, we first utilized a cell–cell fusion assay to obtain potentially cleaved spike protein products from syncytia . In this system, HEK293T cells transfected with plasmids encoding WT spike readily formed syncytia after coculturing with HEK293T cells expressing human and Vero E6-ACE2, as well as colorectal adenocarcinoma Caco-2 and lung adenocarcinoma Calu-3 cells expressing endogenous ACE2. We then collected these adherent syncytia and immunoblotted for cleaved spike species using a rabbit polyclonal antibody specifically detecting the S2 ectodomain through standard reducing Tris-glycine sodium dodecyl sulfate polyacrylamide gel electrophoresis. This experiment revealed that spike expression in HEK293T cells displayed full-length S and autocleaved S2…Is RNA polymerase saturated with substrates in vivo? Describe experiments that might indicate whether RNA polymerase is operating at Vmax with respect to its nucleotide substrates.
- Describe a ChIP-Seq experiment that will enable the identification of promoters to which the stationary phase sigma factor RpoS binds in E. coli. How could you also determine when RpoS binds to DNA?5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…Mechanistic analysis of silencing mechanisms showed that exogenous double-stranded RNA was processed into short fragments (short interfering RNAs or siRNAs) with a similar size to miRNAs. How do mRNAs represent a similar endogenous system to transgene silencing?
- What is meant by Rho dependent and independent transcription termination. What is the differences? Briefly explain.Which set of fragment ions is likely from the same population of precursors ions (parent peptide) from Covid-19 spike protein? b ion NFYEPQI+ and y ion +EPQIITTDK b ion VNNTVYDIP+ and y ion +NNTVYD b ion PLSETK+ and y ion +ALDP All of the described choices are likely. None of the described choices are likely.The U1 splice donor site is critical for positioning of the U1snRNP for appropriate splicing. What site/region(s) participates directly in the phosphoester bond exchange that forms the lariat leading to the correct excision of the intronic segment? Options: the branch point adenosine the poly A stretch within the intron (high conservation ~80%) U2AF binding site (GU) at the 3' intron/exon junction a and b only a, b and c