Suppose that you want to assay reverse transcriptase activity. If polyriboadenylate is the template in the assay, what should you use as the primer? Which radioactive nucleotide should you use to follow chain elongation?

Suppose that you want to assay reverse transcriptase activity. If polyriboadenylate is the template in the assay, what should you use as the primer? Which radioactive nucleotide should you use to follow chain elongation?

Name: Suppose that you want to assay reverse transcriptase activity. If poly
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Suppose that you want to assay reverse transcriptase activity. If polyriboadenylate is the template in the assay, what should you use as the primer? Which radioactive nucleotide should you use to follow chain elongation?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

Suppose that you want to sequence the following DNA fragment: 5′–TCCCGGGAAA-primer site–3′ You first use PCR to amplify the fragment, so that there is sufficient DNA for sequencing. You carry out dideoxy sequencing and then separate the products of the sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the four sequencing reactions.
Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.
During your experiment you analysed only a few of the recombinant clones for the presence of the highly repeated Aluelements. If you wanted to screen for a single-copy gene, you would need to screen a much larger genomic library. Assuming, that you already know the amino acid sequence of unicorn (a species with a similar physiology to humans) insulin, how would you construct a probe which would enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for the insulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors, enzymes, and DNA sequencers.
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…
Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
What assay uses the fact that activators can be separated into DNA binding and activating domains? What information do you gain from this assay? Describe briefly how to perform this assay.
Your cloning vector has restriction recognition sites for two restriction endonucleases, EcorI and BamHI. However, the DNA to be manipulated does not have recognition sites for these two restriction endonucleases. How would you construct a recombinant DNA for the given DNA?
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesis
In the very first round of PCR using genomic DNA, the DNA primers prime synthesis that terminates only when the cycle ends (or when a random end of DNA is encountered). Yet, by the end of 20 to 30 cycles - a typical amplification - the only visible product is defined precisely by the ends of the DNA primers. Explain how.
In producing genetically engineered human insulin in bacteria, why is it important to use the samerestriction enzyme to cut both the human DNA and the bacterial plasmid?
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?