4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.

4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 12TYK

See similar textbooks

Similar questions

4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.
1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger and colleagues published a DNA sequencing procedure based on the principles of DNA replication. This procedure uses in vitro DNA synthesis in the presence of radioactive nucleotides and specific chain-terminators. These specific chain terminators lack a 3' hydroxyl group and are called 2', 3' – dideoxyribonucleoside triphosphates. This means that once a chain terminator is built into the newly synthesized strand, no further synthesis can occur on that particular strand. They are most usually labelled with radioactive 355 (isotope 35 of sulphur). Four reactions are assembled, each containing one each of 2', 3' - dideoxythymidine triphosphate (ddTTP), ddCTP, ddATP or ddGTP. In each reaction tube, all the fragments will end with same base (T, C, A or G). These reactions are each loaded in their own lane and separated by gel electrophoresis, exposed to autoradiograph film (X-ray film) and…
5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two introns in this DNA sequence. Remember introns start with GT and end with AG. (a) How many base pairs are in intron 1 and intron 2.
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
18A. How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?
2A Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the phosphoribosyl backbone and the attachment point for nucleotides added as “A” or “G”. B. Diagram the product of digestion was a restriction enzyme to cut this sequence between the A and G.
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…