Yes or no? Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization? does column of purification in DNA allow it to flow while other molecules are trapped ?
Q: In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during…
A: * Translation is the process in which genetic code is present in a messenger RNA molecule is decoded…
Q: 1. Why is yeast rna is soluble in hot water and diluted sodium hydroxide? 2. Why is yeast rna is…
A: yeast is considered as fungi.
Q: IV. Oswald Avery, McCarty and McLeod (Early 1940s) After Griffith's experiment most scientists…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one…
A: Restriction endonuclease is defined as an enzyme responsible for cleaving DNA into small fragments…
Q: Match the following events in protein synthesis Prompts is the central reaction of protein…
A: Protein biosynthesis, also known as protein synthesis, is an essential biological activity that…
Q: what are the steps of translation in order based on when they occur? It would be nice if some…
A: Translation is the process by which a protein is synthesized from the information contained in a…
Q: es or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr…
A: The polymerase chain reaction (PCR) is an effective method for amplifying nucleic acids (DNA or RNA)…
Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…
A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…
Q: Structural analysis of bacterial release factor 1 (RF-1) and release factor 2 (RF-2) reveals that…
A: Release factors come into the role in the termination of the translation process. Protein synthesis…
Q: What are the stop/nonsense codons?
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: The sequence of the amino acid residues? Accession number at GenBank ? Determine the mRNA sequence…
A: There are a few important points that should be kept in mind : Amino acids are compounds containing…
Q: Problam4: Write the name of atleast 2 protein separation technique and explain any one of them…
A: Following are the methods of proteins separation:- 1. Ultracentrifugation 2. Salt fractionation 3.…
Q: 4. a. A polypeptide contains 36 amino acids. How many nucleotides should be found in the open…
A: Codons are triplets of nucleotides, which codes for specific amino acids. The open reading frame is…
Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…
A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…
Q: Write down the major differences between DNA and RNA. Keeping in mind the concept of “central dogma…
A: Nucleic acids are the biopolymers or large biomolecules which is essential and important to all…
Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…
A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…
Q: quence1…
A: Bioinformatics is a field of biology that uses computational techniques to decipher the structure…
Q: NSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the…
A: The genome of a cell carries various genes that code for one or more proteins. The genes are coded…
Q: Fill in the blanks: Modified True or False: Write BIOCHEM if the statement is true. If the statement…
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…
Q: Fraenkel-Conrat and Singer’s experiment on the genetic material of TMV. What results would you…
A: Tobacco mosaic virus (TMV) is an infectious agent that usually infects the plants specially tobacco…
Q: Ovalbumin is the major protein of egg white. The chicken ovalbumin gene contains eight exons…
A: The genomic information can be used to obtain information for the study. The gene library can be…
Q: Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with…
A: DNA is the genetic material which is found in the nucleus in eukaryotes. Mitochondria and…
Q: bust me int Tly di gerlarat bu nd ambigu 22. Some tRNAS contain inosine, which can base pair with A.…
A: A transfer RNA or tRNA:It is a special type of RNA molecule. It helps in matching of an amino acid…
Q: Translation in mitochondria has many similarities to that ofbacteria explain the similarities?
A: Translation is a process in which ribosomes present in the cytoplasm or endoplasmic reticulum…
Q: - RNA can take part in eukaryotic intron splicing but DNA cannot. Describe in technical detail why…
A: Splicing is a process of removal of non-coding (introns) regions from the gene. Incase of…
Q: SDS-PAGE with and without DDT suggests that a protein contains two peptides linked by a disulfide…
A: SDS-PAGE (Sodium dodecyl sulphate-Polyacrylamide Gel Electrophoresis) alone is not able to cleave…
Q: True/false? if false, justify briefly The bacterial nucleoid comprises linear nucleic acid…
A: The genetic material of the cells is contained in the DNA which has the blueprint for the synthesis…
Q: SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: Mutations and DNA repair. Francis Crick's "wobble pairing" hypothesis suggested an economical…
A: The process by which the information coded in RNA (mRNA) is decoded into a polypeptide is one of the…
Q: 3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human…
A: RT - qPCR - Quantitative reverse transcription PCR (RT-qPCR) is used when the starting material is…
Q: What length of DNA (based on the number of subunits) has a potential diversity close to 3 *10^16?
A: The length of the DNA is determined by corresponding to the base pairs in the DNA and the distance…
Q: What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND…
A: DNA and RNA are important for cell function as DNA provide the information for the cell's…
Q: Write down the major differences between DNA and RNA. Keeping in mind the concept of “central dogma…
A: The central dogma of molecular biology was the process in which DNA was transcripted into RNA and…
Q: posted 8 months ago (last edited 5 mont Mechanism of Microbial Genetics Prior to the elucidation of…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: m-RNA analysis How How to protect the messenger RNA from lysis by proteases?
A: mRNA or messenger RNA is a product of transcription of DNA in the nucleus of a cell. It consists of…
Q: Why is yeast rna is insoluble in cold water, ethanol, diluted hydrochloric acid?
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: Are both statements true? 1. Heterogeneous RNA is a term that refers to mRNA that has not been…
A: As you have posted more than one question we will solve first question for you as per the…
Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…
A:
Q: hy do we keep tissue samples for RNA work in liquid nitrogen (-196°C)? Why do we want to…
A: DNA and RNA can be extracted from the cells for several analytical and other processes by…
Q: Quick help Only cell biology Which process is described in the following paragraph? During DNA…
A: DNA contains the instructions for an organism's or cell's development, reproduction, and death. DNA…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives…
A: The mRNA codon chart is used to find the amino acid with respect to the particular codon.
Q: Yes or no? for each gene, transcription is initiated at origin of replication. does pre mrna…
A: Transcription initiation site is called +1 initiation site. This segment of +1 initiation site is…
Q: RNA: Check all that applies' * susceptible to UV damage. Used to transmit genetic information in…
A: Nucleic acids are polynucleotides of monomeric units or nucleotides, made up of three components: A…
Q: State three major differences between the structures of DNA and RNA
A: The two nucleic acids are deoxyribonucleic acid ( DNA) and ribonucleic acid (RNA). These molecules…
Q: DNA What do thymine (T) and cytosine (C) have in common, that makes them different from Adenine…
A: There are two types of nitrogenous bases: purines and pyrimidine. Purines include adenine and…
Q: WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is…
A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…
Q: the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: DNA polymerase is the main enzyme for replication that is it synthesizes complementary strand…
Q: REPLICATION, TRANSCRIPTION, & TRANSLATION REVIEW DNA REPLICATION Fill in the complementary DNA…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…
Yes or no?
Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization?
does column of purification in DNA allow it to flow while other molecules are trapped ?
Step by step
Solved in 3 steps
- Yes or no? for each gene, transcription is initiated at origin of replication. does pre mrna shorter than mrna? Does one thousand microliters less than a milliliter?Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?
- Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesis- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA.Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translation
- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?Recall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
- You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The direction of the RNA polymerase is given by the arrow. 26) Direction of RNA polymerase amino acid O00000000 large of rib ribosome polypeptide chains B (a) Is the letter A nearer the 5' or the 3' end of the molecule? (b) Is the letter B nearer the 5' or the 3' end of the molecule? (c) Is the letter C nearer the 5' or the 3' end of the tRNA molecule? (d) What is the "S" value for the large rRNA that is closest to the letter D? (e) Which terminus (N or C) of the growing polypeptide chain is nearer to the letter E?In the: The 6 factor that does not dissociate from the RNA polymerase Holoenzyme Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?