5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA molecule as their genetic material. Theoretically, a genome can be made of single stranded DNA, single stranded RNA, double stranded DNA, double stranded RNA and a double stranded hybrid of DNA/RNA. Which type of genomes do the following organisms have? a) Genome 15% G, 0%T, 15%C, 35%U, 35%A b) Genome 31%G, 19%T, 31%C, 0%U, 19%A

13. In your own words, identify one of the reasons why it is difficult to assemble a genome and explain why .

5. A scientist was studying a fragment of eukaryotic DNA that she suspected was involved in a disease process. She isolated the fragment from the genomic DNA and then labeled the ends of the DNA with radioactive tags. This radioactively labeled fragment was then subjected to 3 restriction enzyme digest treatments: EcoRI single digest, BamHI single digest and ECORI/BamHI double digest. The results are shown on the following table. The asterisk (*) indicated fragments containing the radioactive label. Restriction Enzyme Fragment Size (bp) |400, 200*, 100*, 50 350*, 250, 150* 250, 200*, 10o*, 50 ВатHI EcoRI +BamHI Draw the restriction map for this DNA fragment.

7. A mad scientist has all the molecules necessary for protein synthesis in a test tube. Included in this test tube are: template DNA from a giraffe, mRNA from a shark, tRNA from a yeast, ribosomes from a donkey and amino acids from a strawberry. If protein synthesis occurred, the proteins would be from which of the above sources? A. Strawberry B. Giraffe C. Shark D. Yeast E. Donkey Two indo

4). A scientist analyzed a segment of 1 point DNA from a human chromosome and found that the percentage of thymine molecular bases (T) was 35%. Which row in the chart below contains the correct percentages of the other molecular bases in the DNA segment? Row Guanine (G) Cytosine (C) Adenine (A) (1) 15% 25% 25% (2) 25% 25% 15% (3) 15% 15% 35% (4) 35% 15% 15% Row (1) Row (2) Row (3) O Row (4)

3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…

3. In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA Polymerase I. Three Okazaki fragments are shown and the RNA primers (asterisks) have not yet been removed. 3'- -5' 5********** RNA primer Left Okazaki fragment ↑ RNA primer ↑ -||- Middle Okazaki fragment -||- *********** RNA primer Right Okazaki fragment -3' A. Which Okazaki fragment was made first, the one on the left or the one on the right? B. Which RNA primer would be the first one to be removed by DNA polymerase I, the primer on the left or the primer on the right? For this primer to be removed by DNA polymerase I and for the gap to be filled in, is it necessary for the Okazaki fragment in the middle to have already been synthesized? Explain why. C. Let's consider how DNA ligase connects the left Okazaki fragment with the middle Okazaki fragment. After DNA polymerase I removes the middle RNA primer and fills in the gap with DNA, where does DNA…

5. Shorthand DNA is written as antiparallel arrows with 5' and 3' ends. 3' a) What do the 5' and 3' ends signify? b) To which end are new nucleotides added when building a DNA strand?

1. In the sequence grid below, you will fill in all boxes with end polarity, nucleotide, or amino acid as described below. a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words "template" and "coding" (non-template) for the two DNA strands as soon as you figure out which is which. (hint: look at mRNA) b. In the second and last columns, write the polarity of the ends of each sequence (5', 3', N or C). c. The remaining columns represent transcriptional and translational alignments. Fill in all nucleotides, assuming that the template sequences in the table are read from LEFT to RIGHT d. Using the mRNA codon table provided on the next page, determine the polypeptide sequence. This sequence is from the middle of a coding sequence, therefore you do not need a start sequence. T DNA DNA mRNA codon tRNA anticodon polypeptide DNA DNA mRNA codon tRNA anticodon A C polypeptide GLY A C G e. Repeat steps 1a-1d, but now assume that the template…

3. A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation is colored in red.). 5' -GGATGCATGCCCCTCAAAGGGTAAATT-3' (coding strand) 3' -CCTACGTACGGGGAGTTTCCCATTTAA-5' (template strand) What is going to happen to the protein coded by this gene? Write expected amino acid sequence (like Pro-Arg-Tyr-)