5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA molecule as their genetic material. Theoretically, a genome can be made of single stranded DNA, single stranded RNA, double stranded DNA, double stranded RNA and a double stranded hybrid of DNA/RNA. Which type of genomes do the following organisms have? a) Genome 15% G, 0%T, 15%C, 35%U, 35%A b) Genome 31%G, 19%T, 31%C, 0%U, 19%A

5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA molecule as their genetic material. Theoretically, a genome can be made of single stranded DNA, single stranded RNA, double stranded DNA, double stranded RNA and a double stranded hybrid of DNA/RNA. Which type of genomes do the following organisms have? a) Genome 15% G, 0%T, 15%C, 35%U, 35%A b) Genome 31%G, 19%T, 31%C, 0%U, 19%A

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

13. In your own words, identify one of the reasons why it is difficult to assemble a genome and explain why .
3. If the human genome is 3 x 109 bp, the distance between each base pair is 0.34 nm, the diameter of the DNA double helix (form B) is 2 nm, and the volume of a. cylinder is defined by V = πr2h - a) estimate the length of the human genome in cm and b) estimate the volume of the genome in nm3.
5. A scientist was studying a fragment of eukaryotic DNA that she suspected was involved in a disease process. She isolated the fragment from the genomic DNA and then labeled the ends of the DNA with radioactive tags. This radioactively labeled fragment was then subjected to 3 restriction enzyme digest treatments: EcoRI single digest, BamHI single digest and ECORI/BamHI double digest. The results are shown on the following table. The asterisk (*) indicated fragments containing the radioactive label. Restriction Enzyme Fragment Size (bp) |400, 200*, 100*, 50 350*, 250, 150* 250, 200*, 10o*, 50 ВатHI EcoRI +BamHI Draw the restriction map for this DNA fragment.
7. A mad scientist has all the molecules necessary for protein synthesis in a test tube. Included in this test tube are: template DNA from a giraffe, mRNA from a shark, tRNA from a yeast, ribosomes from a donkey and amino acids from a strawberry. If protein synthesis occurred, the proteins would be from which of the above sources? A. Strawberry B. Giraffe C. Shark D. Yeast E. Donkey Two indo
4. Meselson and Stahl's experiments examined DNA after 0, 20 and 40 minutes. Complete the table below to show the percentage of the DNA density after 60 minutes, assuming a) conservative replication and b) semi-conservative replication. Conservative replication Semi-conservative replication Time (mins) 14N/ 14N (light) 14N/15N (intermediate) 15N/15N (heavy) 40 60 40 60 75% 50% 50% 25% 5. What temperatures (°C) are typically used for each step of PCR? Denaturation Anneal primers DNA synthesis
3. The data in the following table represent the base composition of two double stranded DNA sources and their RNA products in experiments conducted in vitro. A+T A+U A+G Species G+C G+C C+U Bacillus subtilis 1.36 |1.30 1.02 E. coli 1.00 |0.98 0.80 From the above data, is it possible to determine whether the RNA of these species is copied from a single strand or from both strands of the DNA? How? (HINT: Drawing a diagram may make it easier to solve this problem). Explain how it is possible to tell whether the RNA itselfis single stranded or double stranded.
4). A scientist analyzed a segment of 1 point DNA from a human chromosome and found that the percentage of thymine molecular bases (T) was 35%. Which row in the chart below contains the correct percentages of the other molecular bases in the DNA segment? Row Guanine (G) Cytosine (C) Adenine (A) (1) 15% 25% 25% (2) 25% 25% 15% (3) 15% 15% 35% (4) 35% 15% 15% Row (1) Row (2) Row (3) O Row (4)
1. how is information from the DNA passes on from one cell to another?2. How does the structure of a DNA molecule hellp account for the great variety of life that exists on earth?3. Does your mRNA model more closely resemble the DNA strand from which it was transcribed?4. Explain how the structure of DNA enables the molecule to be easily transcribed. Why it is important for genetic information?5. Why is RNA important to the cell?6. How does the mRNA molecule carry information from DNA?
1. In the Hershey-Chase experiments, why was DNA labeled with radioactive P and protein with radioactive S? Why not use radioactive carbon for DNA and radioactive nitrogen for protein? Those elements are more abundant in the cells. 2. If Hershey and Chase had picked an RNA virus as their bacteriophage, would the results of their experiment changed? Why or why not?
3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…
5. Shorthand DNA is written as antiparallel arrows with 5' and 3' ends. 3' a) What do the 5' and 3' ends signify? b) To which end are new nucleotides added when building a DNA strand?
3. A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation is colored in red.). 5' -GGATGCATGCCCCTCAAAGGGTAAATT-3' (coding strand) 3' -CCTACGTACGGGGAGTTTCCCATTTAA-5' (template strand) What is going to happen to the protein coded by this gene? Write expected amino acid sequence (like Pro-Arg-Tyr-)