Microbiology: An Evolving Science (Fourth Edition)
4th Edition
ISBN: 9780393615098
Author: John W. Foster, Joan L. Slonczewski
Publisher: W. W. Norton & Company
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7.2, Problem 3TQ
Summary Introduction
To review:
The reason behind the visibility of nalidixic acid-resistant cells even after containing the mutation in gyrA.
Introduction:
The enzyme that changes the supercoiling of the deoxyribonucleic acid (DNA) or regulates the supercoiling level in DNA (deoxyribonucleic acid) is known as topoisomerase. There are two types of topoisomerase present in a cell, topoisomerase I and topoisomerase II. Type I topoisomerase enzymes function by creating transient a single-stranded breaks while type II introduces transient double-stranded breaks.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why would a mutation in a somatic cell of a multicellular organism escape detection?
Cytosine can be deaminated to form Uracil
What type of mutation is this classified as?
Discuss what happens to the base-pairing properties from switching from C to U?
When U is replicated in two rounds of synthesis, what substitution does this result in?
Before Uracil alters the DNA during replication, what repair system can be used to correct this error?
Describe how this type of DNA repair works?
Given that a faulty ribosomal protein is the culprit and causes DBA, discuss the possible role of normal ribosomal proteins. Why might bone marrow cells be more susceptible to such a mutation than other cells?
Chapter 7 Solutions
Microbiology: An Evolving Science (Fourth Edition)
Ch. 7.2 - Prob. 1TQCh. 7.2 - Prob. 2TQCh. 7.2 - Prob. 3TQCh. 7.2 - Prob. 4TQCh. 7.3 - Prob. 1TQCh. 7.3 - Prob. 2TQCh. 7.3 - Prob. 3TQCh. 7.3 - Prob. 4TQCh. 7.3 - Prob. 5TQCh. 7.6 - Prob. 1TQ
Ch. 7.6 - Prob. 2TQCh. 7.6 - Prob. 3TQCh. 7 - Prob. 1RQCh. 7 - Prob. 2RQCh. 7 - Prob. 3RQCh. 7 - Prob. 4RQCh. 7 - Prob. 5RQCh. 7 - Prob. 6RQCh. 7 - Prob. 7RQCh. 7 - Prob. 8RQCh. 7 - Prob. 9RQCh. 7 - Prob. 10RQCh. 7 - Prob. 11RQCh. 7 - Prob. 12RQCh. 7 - Prob. 13RQCh. 7 - Prob. 14RQCh. 7 - Prob. 15RQCh. 7 - Prob. 1TQCh. 7 - Prob. 2TQCh. 7 - Prob. 3TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- During high stress environments, it has been found that some bacteria activate a genetic mechanism that allows them to incorporate more mutations into the DNA during replication. Would the following two enzymes be impacted by such a mechanism? (i)DNA polymerase IIIii) Helicasearrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardWhy might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal protein mutations than other cell types?arrow_forward
- In E. coli, all newly synthesized DNA appears to be fragmented (an observation that could be interpreted to mean that the leading strand as well as the lagging strand is synthesized discontinuously). However, in E. coli mutants that are defective in uracil–DNA glycosylase, only about half the newly synthesized DNA is fragmented. Explain.arrow_forwardCTP synthetase catalyzes the glutamine-dependent conversion of UTP to CTP. The enzyme is allosterically inhibited by the product, CTP. Mamma- lian cells defective in this allosteric inhibition are found to have a complex phenotype: They require thymidine in the growth medium, they have unbal- anced nucleotide pools, and they have an elevated spontaneous mutation rate. Explain the likely basis for these observations.arrow_forwardE. coli DNA polymerase V has the ability to bypass thymine dimers. However, Pol V tends to incorporate G rather than A opposite the damaged T bases. Would you expect Pol V to be more or less processive than Pol III? Explain.arrow_forward
- Which statement is TRUE regarding the DNA ligase mechanism? A)the last step of the reaction proceeds through a tetrahedral intermediate B)ATP is an obligate donor of an adenylyl group in the reaction of the bacterial enzyme C)The high energy of a phosphoanhydride bond is conserved in the reaction D)The phosphate of the AMP product is linked to the 3'-OH of the ribose E)ATP is required as an energy source to overcome the transition state barrierarrow_forwardRifamycins have been used for the treatment of many diseases, including HIV-related Tuberculosis. Explain how Rifamycins inhibit the activities of bacterial DNA dependent RNA polymerase.arrow_forwardTwo possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?arrow_forward
- A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimetho- prim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mam- malian cell mutants defective in thymidylate synthase?arrow_forwardIf deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur? Describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon. A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphology is strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology?arrow_forwarda) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License