Microbiology: An Evolving Science (Fourth Edition)
4th Edition
ISBN: 9780393615098
Author: John W. Foster, Joan L. Slonczewski
Publisher: W. W. Norton & Company
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7.3, Problem 2TQ
Summary Introduction
To review:
The synthesis of deoxyribonucleic acid (DNA) by Escherichia coli DNA polymerase in the given time.
Introduction:
The enzyme that synthesizes the molecules of deoxyribonucleic acid (DNA) from the deoxyribonucleotides is known as DNA polymerase. These enzymes work in pairs to form two identical DNA strands from the parental DNA molecule. It adds the free
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Regarding the process of DNA replication, it is correct to state that:
a) Nucleosomes are maintained during the DNA polymerase-mediated replication process
b) The phosphodiester bonds that join the nitrogenous bases maintain the integrity of the DNA strands
c) DNA polymerase requires a previously annealed deoxynucleotide to add the next monomer being synthesized.
d) The action of the helicase decreases the twist caused by the movement of the replication complex along the stretch of DNA
e)
a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of polymerization and therefore better suited for replication of the genome" What is meant by processivity? how does the DNA polymerase 3 maintain high processivity?
b) What is a replication fork ?. Give the protein/enzymes of a replication fork and describe their function?
What is the end-replication problem? Why, in the absence of telomerase, do the ends of linear chromosomes get progressively shorter each time the DNA is replicated?
Chapter 7 Solutions
Microbiology: An Evolving Science (Fourth Edition)
Ch. 7.2 - Prob. 1TQCh. 7.2 - Prob. 2TQCh. 7.2 - Prob. 3TQCh. 7.2 - Prob. 4TQCh. 7.3 - Prob. 1TQCh. 7.3 - Prob. 2TQCh. 7.3 - Prob. 3TQCh. 7.3 - Prob. 4TQCh. 7.3 - Prob. 5TQCh. 7.6 - Prob. 1TQ
Ch. 7.6 - Prob. 2TQCh. 7.6 - Prob. 3TQCh. 7 - Prob. 1RQCh. 7 - Prob. 2RQCh. 7 - Prob. 3RQCh. 7 - Prob. 4RQCh. 7 - Prob. 5RQCh. 7 - Prob. 6RQCh. 7 - Prob. 7RQCh. 7 - Prob. 8RQCh. 7 - Prob. 9RQCh. 7 - Prob. 10RQCh. 7 - Prob. 11RQCh. 7 - Prob. 12RQCh. 7 - Prob. 13RQCh. 7 - Prob. 14RQCh. 7 - Prob. 15RQCh. 7 - Prob. 1TQCh. 7 - Prob. 2TQCh. 7 - Prob. 3TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In terms of the new DNA strands that are generated, what are the differences between replication and conventional polymerase chain reaction?arrow_forwardIn eukaryotes, the DNA replication rate is 50 nucleotides per second. How long would the replication of a chromosome of 150 million base pairs take if eukaryotic chromosomes were replicated like those of prokaryotes? Actually, eukaryotic replication takes only several hours. How do eukaryotes achieve this high rate?arrow_forwardIn DNA replication, the role of topoisomerase is to Question 11 options: a) "unzip" the double stranded DNA in front of DNA polymerase. b) maintain the single stranded DNA. c) supercoil the DNA after the replication fork has passed. d) relieve supercoil tension in the DNA in front of the replication fork.arrow_forward
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardIf a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?arrow_forward1) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication fork occurs at a rate of 1800 nucleotides per second, how many minutes will it take to completely replicate the chromosome with theta replication? 2) What different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met-Trp-Ile? (Include the stop codon)arrow_forward
- Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency. Cytosine is converted into uracil by loss of its amino group. After this conversion, which base pair occupies this position in each of the daughter strands resulting from one round of replication? Two rounds of replication? (a) How many different 8-mer sequences of DNA are there? (Hint: There are 16 possible dinucleotides and 64 possible trinucleotides.) We can quantify the information- carrying capacity of nucleic acids in the following way. Each position can be one of four bases, corresponding to two bits of information (2² = 4). Thus, a chain of 5100 nucleotides corresponds to 2 × 5100 = 10,200 bits, or 1275 bytes (1 byte =8 bits). (b) How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the human genome? (c) Compare each of these values with the amount of information that can be stored on a computer compact disc, or CD (about 700 megabytes).arrow_forwardWhich of the following is NOT correct concerning the initiation of replication in E. coli? Question 29 options: A) It involves a region of the DNA called oriC. B) DnaA proteins bind to the DNA to begin separation of the strands. C) The strands are initially separated at GC-rich regions of DNA. D) Following initial separation, enzymes continue to separate the parental DNA strands around the rest of the chromosome.arrow_forwardDefine DNA replication/synthesis and semiconservative replication. In addition, describe and/or define the role(s) of each of the following in the process of DNA replication/synthesis: DNA template strand, 5’ and 3’ ends, DNA helicase, DNA polymerase, single-strand binding proteins, topoisomerase, primase, Okazaki fragments, leading strand and lagging strand.arrow_forward
- Does E. coli chromosomal replication always start at one particular site? What is called? If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts? What is the end of E. coli chromosome replication?arrow_forwarda) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.arrow_forwardRegarding the process of DNA replication, is it correct to state that: (Only one statement is correct)* a) Nucleosomes are maintained during the replication process mediated by DNA polymerase b) The phosphodiester bonds that join the nitrogenous bases maintain the integrity of the DNA strands c) DNA polymerase requires a previously annealed deoxynucleotide to add the next monomer being synthesized d) The action of the helicase decreases the twist caused by the movement of the replication complex along the stretch of DNA e) The pre-replicative complex is assembled in the replication origin regions, being activated by proteolytic degradationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY