Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 15P
Diagram a replication fork in bacterial DNA and label the following structures or molecules.
a. DNA pol III
b. helicase
c. RNA primer
d. origin of replication
e. leading strand (label its polarity)
f. DNA pol I
g. topoisomerase
h. SSB protein
i. lagging strand (label its polarity)
j. primase
k. Okazaki fragment
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Match each enzyme name in the left column with the correct descriptive
phrase in the right column.
a. Topoisomerase II
b. DNA ligase
c. DNA polymerase y
d. Reverse transcriptase
i. Catalyzes most nucleotide incorporations
in bacterial DNA replication
ii. Cleaves RNA in a DNA-RNA hybrid
molecule
e. DNA polymerase I
f. DNA polymerase II
iii. Uses a tRNA primer in synthesis of
retroviral DNA
iv. Acts through an adenylylated DNA inter-
mediate
v. Catalyzes formation of a double-strand
DNA break
vi. Catalyzes mitochondrial DNA replication
Which of the following is NOT TRUE about replication?
A. Polynucleotides are made up of deoxynucleotide monophosphates but the substrates are
deoxynucleotide triphosphates
B. The mechanism of the reaction is nucleophilic addition
C. In the formation of primers, nucleotides are added in any direction
D. Both nucleotide triphosphates and deoxynucleotide triphosphates are substrates in
replication
E. Direction of synthesis is 5'23' and lengthens unidirectionally relative to the double strand.
Which of the following statements about RNA is/are incorrect?
I. RNA strand synthesis does not occur during replication.
II. All RNA strands produced during transcription are translated into proteins.
III. RNA strands are composed of 10 nucleotide bases per turn.
IV. RNA strands can pair with a DNA strand.
V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand
O I, II, and IV
O I, II, III, IV, and V
O II, IV and V
O II, IV and V
OI, II, III and V
O Il and III
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a. RNA Polymerase b. DNA Polymerase I c. DNA Polymerase III d. Single Strand binding protein e. Sigma Factor f. Ligase g. Peptidyl transferase h. Primers i. Aminoacyl synthetase j. Gyrase k. Release factors I. Rho factors m. AUG-fmet n. Initiation Factors Identify the following: 1. Catalyzes peptide bond formation between amino acids 2. Binds the amino acid to tis corresponding TRNA 3. Recognizes terminator region 4. Relaxes the tension created by the unwinding process. 5. Complements DNA nucleotides with RNA nucleotides. 6. Complements DNA nucleotides with deoxynucleotide triphosphates. 7. Recognizes UAA, UAG, UGAarrow_forwardThe following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forward
- Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.arrow_forward1)give 3 differences between replication in prokaryotes and replication in Eukaryotes 2)For each item in the following table, decide whether it is related or involved in transcription, translation or replication. 1. Splicing 2. Stop codon 3. Lagging strand 4. RNA polymerase 5. DNA polymerase 6. Telomerase 3) Give the mRNA and the polypeptide (amino acid sequence) that results from the following DNA template strand: DNA template T A C A C G G G C G T A mRNA Amino acid sequencearrow_forward1. DNA polymerase A. Short DNA sequences synthesized on the lagging strand 2. replication fork B. Replicated discontinuously in the 5' to 3' direction 3. Chromosome C. The structure made of DNA that carries genes 4. free nucleotides D. The Cs, Gs, Ts, & As ready to be added to growing chain 5. Topoisomerase F. The Y-shaped point of origin for DNA replication 6. Okazaki Fragment G. Manages the overwinding of DNA ahead of the fork 7. Leading strand H. Lays down nucleotides in DNA replication 8. Lagging strand I. replicated continuously in the 3' - 5' directionarrow_forward
- Which of the following statements are true regarding the properties of DNA and RNA polymerase. Select all that apply. Both DNA and RNA polymerase synthesize nucleic acid strands in the 5" to 3' direction. Both DNA and RNA polymerase can initiate strand synthesis on their own. I. RNA polymerase initiates strand synthesis, while DNA polymerase depends upon an existing strand to continue synthesis. II. RNA polymerase only uses ribonucleotides for strand synthesis. DNA polymerase only uses deoxyribonucleotides for strand synthesis. V. Au DNA and RNA polymerases from eukaryotes behave very differently from DNA and RNA polymerases found in prokaryotes. O VI.arrow_forward32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…arrow_forward1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.arrow_forward
- Match the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicasearrow_forward1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityarrow_forwardMatch the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosomearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY