Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 30P
Using an illustration style and labeling similar to that in Problem
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the DNA sequence of the restriction enzyme:
gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds
GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA
Identify two blunt-end cutters
Identify two sticky-end cutters.
For each,
Provide the sequence of the Restriction enzyme,
Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA
Indicate the…
5'-[seq]-3'
The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed
1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the image below. Based on the band pattern observed here, write out the sequence of both the complementary strand generated during the experiment, and the template strand that is being analyzed. Be sure to clearly indicate the 5' and 3' ends of each. ddATP ddGTP ddCTP || | | ddTTP | 3' 5' Tyne a short answer in the space provided belowarrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forward
- The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||arrow_forwardAfter restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGAarrow_forwardFor the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’arrow_forward
- In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertionarrow_forwardwhat type of gel(in terms of material) can be more suitable for the electrophoresis of 500-1000bp DNA fragment and why?arrow_forwardSequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which picture shows the correct 4 reactions after separation of the sequencing reaction by gel electrophoresis? Template: Primer: 5'-ATCGCTTACCATTAG-3' 5'-CTAAT-3' ddA ddC ddG ddT ddA ddC ddG ddT = D ddA ddC ddG ddT A ddA ddC ddG ddT — B Carrow_forward
- 1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?arrow_forwardFigure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.arrow_forwardIn Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY