Which of the following statements are true regarding the properties of DNA and RNA polymerase. Select all that apply. O. Both DNA and RNA polymerase synthesize nucleic acid strands in the 5' to 3' direction. Both DNA and RNA polymerase can initiate strand synthesis on their own. I. RNA polymerase initiates strand synthesis, while DNA polymerase depends upon an existing strand to continue synthesis. II. O IV. RNA polymerase only uses ribonucleotides for strand synthesis. Oy DNA polymerase only uses deoxyribonucleotides for strand synthesis. DNA and RNA polymerases from eukaryotes behave very differently from DNA and RNA polymerases found in prokaryotes. VI,

Which of the following statements is FALSE regarding the molecular mechanism for DNA polymerases?   A. The active site contains 2 divalent metal ions   B. A single stranded DNA template is required   C. The enzyme can only attach a new deoxynucleotide to the 5’ end of a growing chain   D. The 3’OH on the deoyxyribose ring attacks a phosphate of a dNTP to produce a new phosophodiester bond   E. None of the above (all are true statements)

There are several factors that contribute to high fidelity of DNA replication. Which of the following statements is INCORRECT? DNA polymerase I has a 3'-5' exonuclease editing activity. O b. RNA primers are used instead of DNA primers. There are balanced levels of dNTPs inside the cell. O C. O d. DNA polymerase III has a 3'-5' exonuclease editing activity. O e. Base-pair geometry plays important role for maintaining the high fidelity of DNA synthesis.

As you should recall, DNA, when not being actively transcribed, has a double helical structure.  This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein.  The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template   strand?  ______________________________ Q:  Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA:      ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain:  ________--________--________--________--________--________--________--________