Match the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosome

Match the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosome

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Similar questions

Match the bold DNA repair response(s) to the triggering type of DNA damage. Homologous Recombination Mishmatch Repair Base Excision Repair Nucleotide Excision Repair Non-homologous End Joining Single-strand DNA breaks Removal of repair lesions such as photoproducts caused by UV including Thymine dimers Double-Strand Break repair mechanism which is an accurate repair mechanism without any introduction of insertions or deletions. It requires a sister chromatid as a template. This repair mechanism uses just DNA glycosylase to remove Uracil (no other enzymes or complexes are required) then DNA polymerase can use the template stand to add the complementary base where the Uracil has been removedInterstrand Crosslink Repair This repair mechanism is used to recognize and repair mis-incorporation of base that can arise during DNA replication. Removal and replacement of modifying bases such as Uracil, 8-hyroxyguanine and others. Double-strand Break that is termed as “Quick and Dirty” as it is…
Identify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.
The general excision repair pathway for DNA repair has the following order A. endonuclease cuts → DNA ligase removes → endonuclease removes → DNA ligase B. DNA ligase → DNA polymerase → helicase or endonuclease removes → endonuclease cuts C. endonuclease cuts → helicase or endonuclease removes → DNA polymerase → DNA ligase D. endonuclease cuts → DNA polymerase repairs → helicase opens up → DNA ligase
What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…
Match the DNA repair mechanism to the type of repair it fixes. Base excision repair DNA polymerase proofreading Non-homolgous end-joining Mismatch repair Nucleotide excision repair Double strand breaks Mismatches in S-phase Mismatches after S-phase, before M-phase Mismatches in interphase Thymidine Dimer Double strand breaks Mismatches in S-phase Mismatches after S-phase, before…
Describe the role of the proteins involved with DNA replication. Also identify if the protein is involved the leading strand, lagging strand or both. DNA Ligase DNA Polymerase I DNA Polymerase III Helicase Primase Single-stranded DNA-binding proteins Topoisomerase
List the steps in the correct order of DNA mismatch repair in E. coli Group of answer choices a. Mut S; Mut H; Mut L; Mut H cleaves unmethylated new DNA strand b. Mut H; Mut L; Mut S; Mut H cleaves unmethylated nascent DNA strand c. Mut H; Mut S; Mut L; Mut H cleaves unmethylated nascent DNA strand d. Mut L; Mut H; Mut S; Mut H cleaves unmethylated nascent DNA strand
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Which of the following is/are true of DNA general recombination? The process involves invasion of a single-stranded DNA with a free 3'-end into a DNA duplex with the same sequence (on one strand) The process involves formation and resolution of a Holliday structure. The process involves use of a restriction endonuclease. The process involves synthesis of DNA by DNA polymerase.
The mismatch DNA repair mechanism is based on the fact that: O a. O b. O C. O d. The parental DNA strand is recognized because it is structurally distorted. The parental DNA strand is methylated while daughter strand is not. The daughter DNA strand is recognized because it is structurally distorted. The daughter DNA strand is methylated while parental strand is not.
All of the following proteins function during nucleotide excision repair, EXCEPT: A. DNA pol B. Uvr A C. Uvr C D. Ligase E. Gyrase
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity