Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 5P
One strand of a fragment of duplex DNA has the sequence
a. What is the sequence of the other strand in the duplex?
b. What is the name of the bond that joins one
c. Is the bond in part (b) a covalent or a noncovalent bond?
d. Which chemical groups of nucleotides react to form the bond in part (b)?
e. What enzymes catalyze the reaction in part (d)?
f. Identify the bond that joins one strand of a DNA duplex to the other strand.
g. Is the bond in part (f) a covalent or a noncovalent bond?
h. What term is used to describe the pattern of base pairing between one DNA strand and its partner in a duplex?
i. What term is used to describe the polarity of two DNA strands in a duplex?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’
a. Write the sequence for the complementary DNA strand.
b. Write the sequence of the RNA complementary to the strand shown
Suppose the following base sequence was found in a segment of one
strand of a DNA molecule: 3’ A-A-T-A-C-C-T-C-C-T-A-A-C-T 5’
What would be the bases in the complementary strand? Label the 3’ and the 5’ ends.
Illustrate the DNA molecule below. Label the 3’ and the 5’ ends of both strands.
Separate the above DNA molecule up to the seventh base. Add one primer for the leading strand complementary to the first base Adenine of the template strand. Add one primer for the lagging strand complementary to the seventh base Adenine of the template strand. Illustrate the DNA molecule. Label the 3’ and 5’ ends.
Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’ ends of the template strands and the complementary strands.
Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’…
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate
groups are filled circles.
A. Is this a DNA or an RNA Molecule?
B. Where is the 3’ end of this tetranucleotide?
C. Given that the DNA strand which served as a template for the synthesis of this
tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase? a. polarity of the strands b. thickness of the helix c. tilt of the bases d. appearance of the major and minor groovearrow_forwardWhat defines one end of a DNA molecule as the 5’ end? a. What defines the other end at the 3’ end? b. When two strands of DNA are paired together to form a functional molecule, what is interesting to note about their 5’ and 3’ ends?arrow_forwardOne strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?arrow_forward
- What describes or designates the 3' end of a DNA strand? a. an available hydroxyl group on the 5th carbon of a deoxyribose of a terminal nucleotide b. an available phosphate group on the 3rd carbon of a deoxyribose of a terminal nucleotide c. an available hydroxyl group on the 3rd carbon of a deoxyribose of a terminal nucleotide d. an available hydroxyl group on the 2nd carbon of a deoxyribose of a terminal nucleotidearrow_forwardSuppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forward– Draw a DNA strand with 10 adenine bases followed by 10 cytosine bases. If that same strand bonded to a strand of 15 thymine bases and 5 guanine bases, how would the double helix shape vary from a typical DNA double helix? Explain why. Must draw picture of both strands that helps to illustrate your written answer – no credit for one without the other.arrow_forward
- A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both partsarrow_forwardEnzymes can break down the DNA catalyze the hydrolysis of the covalent bonds that join nucleotides together. What would happen to DNA molecules treated with these enzymes? a. The two strands of the double helix would separate b. The phosphodiester linkages of the polynucleotide backbone would be broken. c. The pyrimidines would be separated from the deoxyribose sugar. d. All bases would be separated from the deoxyribose sugars.arrow_forwardDraw the structure of each dinucleotide and identify the 5 'and 3 ' ends. a. the deoxyribonucleotide formed by joining two deoxyguanosine 5 '-phosphates together b. the ribonucleotide formed by joining the 5 '-phosphate of UMP with the 3 '-OH of AMParrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license