1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
1 a)The
3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’
| a. |
3’ – CGCATAGC – 5’ |
|
| b. |
3’ – CGCAUAGC – 5’ |
|
| c. |
3’ – CGUCGAGC – 5’ |
|
| d. |
3’ – CGUCGAGC – 5’ |
|
| e. |
None of the above |
b)
Which one of the following statements is true?
| a. |
The lac repressor and catabolite activator protein are both controlled by allosteric binding |
|
| b. |
The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor |
|
| c. |
The lac repressor is inhibited by lactose through competitive inhibition |
|
| d. |
β-galactosidase will hydrolyze galactose to form glucose and lactose |
|
| e. |
The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity |
Step by step
Solved in 2 steps
