1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’   a. 3’ – CGCATAGC – 5’   b. 3’ – CGCAUAGC – 5’   c. 3’ – CGUCGAGC – 5’   d. 3’ – CGUCGAGC – 5’   e. None of the above

From the following DNA template, which sequence is synthesized by RNA Polymerase?    5’- T  – C – C – T – A – A – G – A –3’ Group of answer choices 5’- A – G – G – A – T – T – C – T –3’ 5’- U – C – C – U – A – A – G – A –3’ 3’- A – G – G – A – U – U – C – U –5’ 3’- T – C – C – T – A – A – G – A –5’ 3’- T – G – G – A – T – T – C – T –5’

32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…

a) what si the nucleotide at the 5 prime end of the picture?   b) what si the DNA sequence from 5 prime to 3 prime    pls help, urgently required, no explanation needed

In the boxes below, complete the Original DNA, DNA Copy and/or RNA

Label the diagram to the corresponding letter

The type of DNA replication error illustrated in the diagram below is _______________________.

Which of the following sequences is the best description of the complementary DNA sequence to the following sequence:   5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'

The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’   a. 5’ – CGAUACGC – 3’   b. 5’ – CGATACGC – 3’   c. 5’ – CGAGCUGC – 3’   d. 5’ – CGAGCTGC – 3’   e. None of the above

a. what is the nucleotide sequence of the DNA chain synthesized from the primer. label the 5' to 3' ends b. what is the nucleotide sequence of the DNA chain use as the template strand. label the 5' and 3' ends c. write out the nucleotide sequence of the DA double helix (label the 5' and 3' ends)