Human Physiology
15th Edition
ISBN: 9781259864629
Author: Fox, Stuart Ira
Publisher: Mcgraw-hill Education,
expand_more
expand_more
format_list_bulleted
Question
Chapter 3, Problem 38RA
Summary Introduction
To review:
The number of bases in each exon, if all the exons share the same length.
Introduction:
Introns and exons are the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The table attached shows a partial DNA sequence from a human. Answer the following questions based on the table
A. Name the codon that is formed from base triplet number 2 on the DNA sequence.
B. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names
C. Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following:
the amino terminus (N)
the carboxyl terminus (C)
a peptide bond
an α-carbon atom
D. If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed?
E.The following is a sequence of base triplets in DNA
F.If guanine, found in the first base triplet, is removed, explain how this would affect the…
Define the following terms: genetic code, codon, and anticodon. What is the relationship among the bases in DNA, the codons of mRNA, and the anticodons of tRNA?
How many RNA bases are required to code for a protein that contains 250 amino acids?
Explain your answer.
Chapter 3 Solutions
Human Physiology
Ch. 3 - According to the fluid-mosaic model of the plasma...Ch. 3 - After the DNA molecule has replicated itself, the...Ch. 3 - Nerve and skeletal muscle cells in the adult,...Ch. 3 - Prob. 4RACh. 3 - The phase of mitosis in which the chromatids...Ch. 3 - Prob. 6RACh. 3 - Which of these statements about RNA is true?...Ch. 3 - Prob. 8RACh. 3 - Prob. 9RACh. 3 - Prob. 10RA
Ch. 3 - Prob. 11RACh. 3 - Which of these statements about tRNA is true?...Ch. 3 - The step in protein synthesis during which tRNA,...Ch. 3 - Prob. 14RACh. 3 - Prob. 15RACh. 3 - Prob. 16RACh. 3 - Give some specific examples that illustrate the...Ch. 3 - Describe the structure of nucleosomes, and explain...Ch. 3 - What is the genetic code, and how does it affect...Ch. 3 - Why may tRNA be considered the "interpreter" of...Ch. 3 - Prob. 21RACh. 3 - Define the terms genome and proteome, and explain...Ch. 3 - Prob. 23RACh. 3 - Explain the functions of centrioles in nondividing...Ch. 3 - Prob. 25RACh. 3 - Prob. 26RACh. 3 - Define apoptosis and explain the physiological...Ch. 3 - Describe what is meant by epigenetic inheritance,...Ch. 3 - Discuss the role of chromatin proteins in...Ch. 3 - Explain how p53 functions as a tumor suppressor...Ch. 3 - Prob. 31RACh. 3 - Antibiotics can have different mechanisms of...Ch. 3 - Explain how it is possible for the human proteome...Ch. 3 - Explain RNA interference RNAi by siRNA and miRNA...Ch. 3 - Describe the function and significance of...Ch. 3 - Prob. 36RACh. 3 - Review figure 3.19 and answer the following...Ch. 3 - Prob. 38RACh. 3 - Describe the structure of the plasma membrane.Ch. 3 - Describe the structure and function of cilia,...Ch. 3 - Prob. 2aCPCh. 3 - Prob. 2bCPCh. 3 - Prob. 3aCPCh. 3 - Prob. 3bCPCh. 3 - Describe the structure and functions of...Ch. 3 - Prob. 3dCPCh. 3 - Describe the structure and function of ribosomes.Ch. 3 - Distinguish the two types of endoplasmic reticulum...Ch. 3 - Describe the appearance and composition of...Ch. 3 - Explain how RNA is produced within the nucleus...Ch. 3 - Explain how precursor mRNA is modified to produce...Ch. 3 - Explain how mRNA. rRNA, and tRNA function during...Ch. 3 - Describe the rough endoplasmic reticulum, and...Ch. 3 - Describe post-translational changes and other...Ch. 3 - Draw a simple diagram of the semiconservative...Ch. 3 - Describe the cell cycle using the proper symbols...Ch. 3 - Prob. 10bCPCh. 3 - List the phases of mitosis and briefly describe...Ch. 3 - Distinguish between mitosis and meiosis, describe...
Knowledge Booster
Similar questions
- a) Identify three types of RNA and provide a description of each and the role they play in protein synthesis. (6 marks) b) Use the DNA sequence below to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? (1 mark) What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? (1 mark) Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence. (2 marks) Paragraph I A + v ... Lato (Recom... v 19px ... v Add a File Record Audio Record Video MacBook Pro G Search or type URL #3 2$ & ( 3 4 7 8 9 山訓 < COarrow_forwardIdentify which regions of DNA encode the protein sequence. Consider that there may be introns (which often start with sequence GU and end with the sequence AG).arrow_forwardUse the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme B-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threoninearrow_forward
- Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Serarrow_forwardCalculate the number of amino acids encoded by a DNA sequence of 27 nucleotides.arrow_forwardA DNA strand consists of any sequence of four kinds of nucleotides. Suppose there were only 14 different amino acids instead of 20. Which of the following statements would be correct descriptions of the minimal number of nucleotides necessary to create a genetic code? a) 1 b)2, provided that chain termination does not require a special codon c) 3, provided that chain termination does require a special codon d)2, no matter how chain termination is accomplished e) Both b and carrow_forward
- DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?arrow_forwardDetermine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence. Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)arrow_forwardDetermine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence. Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) 3' TACATGGTTGTGCTAATT 5' Carrow_forward
- What are the sequences of all the possible tripeptides that contain the amino acids, serine, leucine and phenylalanine? Use 3-letter abbreviations to express your answer.arrow_forwardWhat is the first amino acid in the polypeptide? _____________________ A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the polypeptide that results? _________ What is the resulting polypeptide: _______________________________________________________?arrow_forwardAn RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G = 15%. (A) Is this RNA molecule single-stranded or double stranded? How can you tell? (B) What would be the percentage of each of the bases in the template strand of the DNA that contains the gene for this RNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning