Human Physiology
15th Edition
ISBN: 9781259864629
Author: Fox, Stuart Ira
Publisher: Mcgraw-hill Education,
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 37RA
Review figure 3.19 and answer the following questions about a protein that is composed of 600 amino acids.
If the gene coding for this protein contains two introns, how many exons does it contain?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping.
How many codons are represented in this oligonucleotide?
If the second G were changed to a C, what would be the resulting amino acid?
Refer to the genetic code in Figure 15.10 to answer the following question
Q. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence?
Refer to the genetic code in Figure 15.10 to answer the following question
Q. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence?
Chapter 3 Solutions
Human Physiology
Ch. 3 - According to the fluid-mosaic model of the plasma...Ch. 3 - After the DNA molecule has replicated itself, the...Ch. 3 - Nerve and skeletal muscle cells in the adult,...Ch. 3 - Prob. 4RACh. 3 - The phase of mitosis in which the chromatids...Ch. 3 - Prob. 6RACh. 3 - Which of these statements about RNA is true?...Ch. 3 - Prob. 8RACh. 3 - Prob. 9RACh. 3 - Prob. 10RA
Ch. 3 - Prob. 11RACh. 3 - Which of these statements about tRNA is true?...Ch. 3 - The step in protein synthesis during which tRNA,...Ch. 3 - Prob. 14RACh. 3 - Prob. 15RACh. 3 - Prob. 16RACh. 3 - Give some specific examples that illustrate the...Ch. 3 - Describe the structure of nucleosomes, and explain...Ch. 3 - What is the genetic code, and how does it affect...Ch. 3 - Why may tRNA be considered the "interpreter" of...Ch. 3 - Prob. 21RACh. 3 - Define the terms genome and proteome, and explain...Ch. 3 - Prob. 23RACh. 3 - Explain the functions of centrioles in nondividing...Ch. 3 - Prob. 25RACh. 3 - Prob. 26RACh. 3 - Define apoptosis and explain the physiological...Ch. 3 - Describe what is meant by epigenetic inheritance,...Ch. 3 - Discuss the role of chromatin proteins in...Ch. 3 - Explain how p53 functions as a tumor suppressor...Ch. 3 - Prob. 31RACh. 3 - Antibiotics can have different mechanisms of...Ch. 3 - Explain how it is possible for the human proteome...Ch. 3 - Explain RNA interference RNAi by siRNA and miRNA...Ch. 3 - Describe the function and significance of...Ch. 3 - Prob. 36RACh. 3 - Review figure 3.19 and answer the following...Ch. 3 - Prob. 38RACh. 3 - Describe the structure of the plasma membrane.Ch. 3 - Describe the structure and function of cilia,...Ch. 3 - Prob. 2aCPCh. 3 - Prob. 2bCPCh. 3 - Prob. 3aCPCh. 3 - Prob. 3bCPCh. 3 - Describe the structure and functions of...Ch. 3 - Prob. 3dCPCh. 3 - Describe the structure and function of ribosomes.Ch. 3 - Distinguish the two types of endoplasmic reticulum...Ch. 3 - Describe the appearance and composition of...Ch. 3 - Explain how RNA is produced within the nucleus...Ch. 3 - Explain how precursor mRNA is modified to produce...Ch. 3 - Explain how mRNA. rRNA, and tRNA function during...Ch. 3 - Describe the rough endoplasmic reticulum, and...Ch. 3 - Describe post-translational changes and other...Ch. 3 - Draw a simple diagram of the semiconservative...Ch. 3 - Describe the cell cycle using the proper symbols...Ch. 3 - Prob. 10bCPCh. 3 - List the phases of mitosis and briefly describe...Ch. 3 - Distinguish between mitosis and meiosis, describe...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forwardRefer to the genetic code in Figure 15.10 to answer the following question Q. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forward
- Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Glutamic Acid-Glutamic Acid-COO- (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Valine-Glutamic Acid-COO- (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.arrow_forwardGive the initiation codon for protein synthesis. Name the amino acid it codes for?arrow_forwardIn 3-4 sentences each Explain the difference between an intron and an exon? Explain what happens when eIF-2 is phosphorylated and when it is not phosphorylated?arrow_forward
- A gene contains 141 codons. How many nucleotides are present in the gene’s coding sequence? How many amino acids are expected to be present in the polypeptide encoded by this gene?arrow_forwardA mutation in the first intron of the Minnie gene gives rise to a shorter, truncated form of the Minnie protein that only includes amino-acids encoded by Exon 1 and 3. What kind of mutation in intron 1 could lead to this? Explain how this mutation would lead to a truncated protein. (100 words max.)arrow_forwardRefer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U G G G C U U U... beginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? A) Thr-Met- Gly B) Met-Gly-Phe C) Ser-Asp-Gly-Leu .arrow_forward
- You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3arrow_forwardBelow is an MRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz are numbered as shown. Answer questions 1-4 for the mRNA of Lstqz. A codon table with amino acids shown in single-letter code has been provided at this link. 1 5 10 15 20 25 30 35 40 5' AGAGAUGGCUCCUUCACGCUUUACCUACUGAGUAGGGCUAAG 3’ Which nucleotide number corresponds to the first nucleotide of the stop codon? (Please answer as a numeric value) 30 Write down the first five amino acids generated from this mRNA in single-letter designation with no spaces. Example: if the answer is (from N to C terminus) Histidine-Threonine-Glutamate, you would put in HTE (uppercase) as the answer.arrow_forwardIf DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate different proteins? What are the 3 tRNA sites on the small ribosomal subunit (just abbreviations)? What is the order of tRNA entrance and exit through the ribosome?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY