Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 26, Problem 20CONQ
Summary Introduction
To review:
The essential features of oocytes for animal development and the need for enucleated egg in the cloning of mammals.
Introduction:
Mammals are vertebrate animals and belong to the class Mammalia. They have characteristics features, like the females of mammals have mammary glands through which they feed milk to their offspring.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Is it acceptable or not to edit the genome of human embryos to treat genetic diseases?
There is a group of genetic disorders that cause fatal childhood diseases. To avoid having children with these genetic disorders, some parents choose to use a procedure called in vitro fertilization (IVF) followed by genetic testing. Typically, in the first step of IVF, women receive hormone injections to produce multiple eggs, after which the eggs are harvested. The eggs are then fertilized by sperm in a petri dish to make embryos, which are then transferred to a woman's uterus. If the goal is to identify embryos that do not have specific genetic conditions, doctors would screen the embryos before they are implanted into the woman - in other words, they would analyze the embryos' DNA to look for variants of the gene(s) that cause the genetic disorder. While the genetic testing of IVF-produced embryos has been done for decades, the procedure is controversial. The controversies include worries that…
Outline the steps of reproductive cloning in mammals.
Dolly is the first mammal to have been successfully cloned from an adult cell Which of the following statement/s is/are most relevant to the birth of Dolly?
I. It suggests that human could be cloned.
II. It proves that specialized cells could be used to create an exact copy of the animal they came from.
III. It improves the production of milk, meat, and other products from livestock.
IV. It proves that animals could be cloned to have gene mutations that help scientists study diseases that develop in the animals.
A. II only
B. I and II
C. III, and IV
D. II, III, and IV
Which of the following statements best explain the significance of mitosis and ?
A. Both mitosis and meiosis produce diploid cells which responsible for the continuity of life.
B. Many single-celled organisms rely on mitosis and meiosis as their primary means of asexual reproduction
C. replication, cells have another interesting choice, whether they want to make an identical copy, or do they want to make four half-copies…
Chapter 26 Solutions
Genetics: Analysis and Principles
Ch. 26.1 - Prob. 1COMQCh. 26.1 - Prob. 2COMQCh. 26.1 - Which of the following is the correct order for...Ch. 26.2 - Prob. 1COMQCh. 26.2 - Prob. 2COMQCh. 26.2 - Prob. 3COMQCh. 26.2 - Prob. 4COMQCh. 26.3 - Prob. 1COMQCh. 26.3 - Prob. 2COMQCh. 26.3 - 3. Myogenic bHLH proteins are ___________ that...
Ch. 26.4 - Prob. 1COMQCh. 26.4 - Prob. 2COMQCh. 26.5 - 1. A key event that initially determines female or...Ch. 26.5 - Prob. 2COMQCh. 26 - 1. What four types of cellular processes must...Ch. 26 - Prob. 2CONQCh. 26 - Prob. 3CONQCh. 26 - 4. Which of the following statement(s) is/are true...Ch. 26 - Discuss the morphological differences between the...Ch. 26 - Prob. 6CONQCh. 26 - Explain what a morphogen is, and describe how it...Ch. 26 - 8. What is positional information? Discuss three...Ch. 26 - Prob. 9CONQCh. 26 - Prob. 10CONQCh. 26 - 11. Describe the function of the Bicoid protein....Ch. 26 - With regard to development, what are the roles of...Ch. 26 - Discuss the role of homeotic genes in development....Ch. 26 - Describe the molecular features of the homeobox...Ch. 26 - What would you predict to be the phenotype of...Ch. 26 - Prob. 16CONQCh. 26 - If a mutation in a homeotic gene produced the...Ch. 26 - 18. Explain how loss-of-function mutations in the...Ch. 26 - What is the difference between a maternal-effect...Ch. 26 - Prob. 20CONQCh. 26 - Prob. 21CONQCh. 26 - Prob. 22CONQCh. 26 - 23. Discuss the similarities and differences...Ch. 26 - 24. What is cell differentiation? Discuss the role...Ch. 26 - Prob. 25CONQCh. 26 - What is a totipotent cell? In each of the...Ch. 26 - 27. What is a meristem? Explain the role of...Ch. 26 - Prob. 28CONQCh. 26 - Predict the phenotypic consequences of each of the...Ch. 26 - 30. Explain how alternative splicing affects sex...Ch. 26 - Prob. 1EQCh. 26 - Compare and contrast the experimental advantages...Ch. 26 - 3. What is meant by the term cell fate? What is a...Ch. 26 - 4. Explain why a cell lineage diagram is necessary...Ch. 26 - Explain the rationale behind the use of the bag of...Ch. 26 - Prob. 6EQCh. 26 - Take a look at question 2 in More Genetic TIPS...Ch. 26 - All of the homeotic genes inDrosophilahave been...Ch. 26 - Prob. 9EQCh. 26 - wo techniques commonly used to study the...Ch. 26 - Prob. 11EQCh. 26 - Prob. 12EQCh. 26 - 13. Another way to study the role of proteins...Ch. 26 - 14. Why have geneticists used reverse genetics to...Ch. 26 - Prob. 1QSDCCh. 26 - Prob. 2QSDCCh. 26 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardWhat are some master genes important in embryonic development? Discuss.arrow_forwardA controversial issue, closely related to cloning, that has caused a lot of debate is the use of embryonic stem cells. One possible application of these cells is that they may be able to supply replacement tissues to treat diseases such as Parkinson's disease, diabetes, paralysis due to spinal cord injuries, and other degenerative diseases. The word "embryonic", has caused fierce opposition to this type of research because embryos are destroyed when the stem cells are removed. Questions that have surfaced in this debate include: When a cell nucleus is transferred to another cell, have we created life? Does a stem cell have the same status as a human? What should be done with the embryos that are leftover at in vitro fertilization (IVF), clinics? Advocates argue that the medical benefits of stem cell research would be enormous. Opponents argue that life begins at conception and thus this type of research is abortion. Based on what you have read, explain why you are for or against stem…arrow_forward
- Woolly mammoths have been extinct for about 4,000 years, but we often find their well-preserved remains in Siberian permafrost. Research groups are now planning to use SCNT to resurrect these huge elephant-like mammals. No mammoth eggs have been recovered yet, so elephant eggs would be used instead. An elephant would also be the surrogate mother for the resulting embryo. The researchers may try a modified SCNT technique used to clone a mouse that had been dead and frozen for 16 years. Ice crystals that form during freezing break up cell membranes, so cells from the frozen mouse were in bad shape. Their DNA was transferred into donor mouse eggs, and cells from the resulting embryos were fused with undifferentiated mouse cells. Four healthy clones were born from the hybrid embryos. What are some of the pros and cons of cloning an extinct animal?arrow_forwardIn contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?arrow_forwardYou found a strain of mutant fruit flies (Drosophila) living on the rotten bananas in your dorm room. You notice that many of the larvae have abnormal abdominal segments. You want to know if the “abdomenless” mutation is a maternal effect gene. Describe an experiment you would do to determine this, and the results that would support and contradict the notion that the abdomenless gene encodes a maternal determinant.arrow_forward
- Although several different mammalian species have been cloned, the efficiency of this process is extremely low. Often tens or even hundreds of oocytes must be implanted with donor nuclei to obtain one healthy live birth. Many researchers believe the difficulties with cloning reside in the epigenetic modifications, such as DNA and histone methylation, that occur within various cells during an individual’s life. How do you suspect such modifications might affect the success of an experimentarrow_forwardWhat are some of the major impediments to genetically modifying human embryos?arrow_forwardThe following diagram outlines how the process of cloning a sheep was accomplished. Cloning is the process of creating a genetically identical copy of another individual. With Dolly, the first cloned mammal, an egg cell was removed from a donor (B) and the nucleus was removed from the egg cell. Then cells from a sheep's mammary gland were removed from a second donor (A). The nucleus of one of the cells from the mammary gland was fused with the enucleated egg cell using an electrical pulse. The fused cell underwent cell division and at the blastocyst stage was implanted into a surrogate mother sheep. The fused cell is cultured and is implanted as a multi-celled embryo. During the step where the fused cell begins dividing normally, the cells of the future clone undergo Select one: a. fertilization b. meiosis c. mitosis d. gene splicingarrow_forward
- The following diagram outlines how the process of cloning a sheep was accomplished. Cloning is the process of creating a genetically identical copy of another individual. With Dolly, the first cloned mammal, an egg cell was removed from a donor (B) and the nucleus was removed from the egg cell. Then cells from a sheep's mammary gland were removed from a second donor (A). The nucleus of one of the cells from the mammary gland was fused with the enucleated egg cell using an electrical pulse. The fused cell underwent cell division and at the blastocyst stage was implanted into a surrogate mother sheep. The percentage of genetic material that Dolly (the clone) had in common with Donor A is Select one: a. 25% b. 50% c. 100% d. 0%arrow_forwardWhich of the following illustrates the regulative nature of early mouse development? (a) the mouse embryo is freeliving prior to implantation in the uterus (b) it is possible to produce a transgenic mouse (c) it is possible to produce a mouse in which a specific gene has been knocked out(d) genes related to Drosophila homeotic genes have been identified in mice (e) a chimeric mouse can be produced by fusing two mouse embryosarrow_forwardDraw a basket mutant embryo. What does basket encode? Why do the mutant embryos have this phenotype?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License