Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 26, Problem 13EQ
Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted
A. Nanos mRNA injected into the anterior end of an oocyte
B. Antp protein injected into the posterior end of an embryo
C. Toll mRNA injected into the dorsal side of an early embryo
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
An embryologist measures the concentrations of three morphogens (A, B, C) in a row of cells across an embryo, from anterior to posterior. The morphogens
cause the expression of various colored pigments as indicated in the graphs.
Anterior
Posterior
Expression of Blue protein only
[A]
Expression of Red protein only
Expression of Green protein only
Anterior
Posterior
[B]
Repression of Purple protein
Activation of Red protein
Anterior
Posterior
[C]
Activation of Yellow protein
Which shows the correct expression of pigments expressed in response to Morphogen A?
Anterior
Posterior
Anterior
Posterior
Anterior
Posterior
Anterior
Posterior
You are interested in the effects of mutations on the expression of a human protein-
encoding gene expressed in skin cells. The gene has one intron that is 450
nucleotides long. After this intron is removed from the pre-mRNA, the mRNA
transcript is 1100 nucleotides in length. Diploid somatic cells have two copies of this
gene. Predict the size and amount of mRNA from the cytosol of skin cells, which
were obtained from the following individuals:
• Individual 1: Normal individual with no mutations in this gene.
• Individual 2: Homozygous for a deletion that removes the -10 to -100 region of
the gene that encodes this mRNA.
• Individual 3: Heterozygous in which one gene is normal and the other gene has a
deletion that removes the -10 to -100 region.
• Individual 4: Homozygous for a five-nucleotide deletion in the intron that
removes the GT sequence at the 5' splice site.
Explain your answers.
Maternal and zygotic mRNAs regulate embryonic development by determining major body axes. Two of the these mRNAs code for the proteins ____ (of maternal origin) and (of zygotic origin), which are morphogens that accumulate at the end of the egg that will become the anterior end of the embryo, whereas two other mRNAs code for the morphogens ____ (maternal origin) and ____ (zygotic origin), which accumulate at the opposite end of the egg and determine the posterior end of the embryo. The dorso-ventral axis of the embryo is established by two morphogens coded for by maternal mRNAs: (1) ____, which is transcribed in the egg nucleus and accumulates in a crescent on the side of the egg that will become the dorsal surface; and (2) ____, which is transported after fertilization into blastodermal cells that will become the ventral surface, and in these cells activates the zygotic gene ____, which produces a protein that diffuses to the blatodermal cells at the opposite side of the egg and…
Chapter 26 Solutions
Genetics: Analysis and Principles
Ch. 26.1 - Prob. 1COMQCh. 26.1 - Prob. 2COMQCh. 26.1 - Which of the following is the correct order for...Ch. 26.2 - Prob. 1COMQCh. 26.2 - Prob. 2COMQCh. 26.2 - Prob. 3COMQCh. 26.2 - Prob. 4COMQCh. 26.3 - Prob. 1COMQCh. 26.3 - Prob. 2COMQCh. 26.3 - 3. Myogenic bHLH proteins are ___________ that...
Ch. 26.4 - Prob. 1COMQCh. 26.4 - Prob. 2COMQCh. 26.5 - 1. A key event that initially determines female or...Ch. 26.5 - Prob. 2COMQCh. 26 - 1. What four types of cellular processes must...Ch. 26 - Prob. 2CONQCh. 26 - Prob. 3CONQCh. 26 - 4. Which of the following statement(s) is/are true...Ch. 26 - Discuss the morphological differences between the...Ch. 26 - Prob. 6CONQCh. 26 - Explain what a morphogen is, and describe how it...Ch. 26 - 8. What is positional information? Discuss three...Ch. 26 - Prob. 9CONQCh. 26 - Prob. 10CONQCh. 26 - 11. Describe the function of the Bicoid protein....Ch. 26 - With regard to development, what are the roles of...Ch. 26 - Discuss the role of homeotic genes in development....Ch. 26 - Describe the molecular features of the homeobox...Ch. 26 - What would you predict to be the phenotype of...Ch. 26 - Prob. 16CONQCh. 26 - If a mutation in a homeotic gene produced the...Ch. 26 - 18. Explain how loss-of-function mutations in the...Ch. 26 - What is the difference between a maternal-effect...Ch. 26 - Prob. 20CONQCh. 26 - Prob. 21CONQCh. 26 - Prob. 22CONQCh. 26 - 23. Discuss the similarities and differences...Ch. 26 - 24. What is cell differentiation? Discuss the role...Ch. 26 - Prob. 25CONQCh. 26 - What is a totipotent cell? In each of the...Ch. 26 - 27. What is a meristem? Explain the role of...Ch. 26 - Prob. 28CONQCh. 26 - Predict the phenotypic consequences of each of the...Ch. 26 - 30. Explain how alternative splicing affects sex...Ch. 26 - Prob. 1EQCh. 26 - Compare and contrast the experimental advantages...Ch. 26 - 3. What is meant by the term cell fate? What is a...Ch. 26 - 4. Explain why a cell lineage diagram is necessary...Ch. 26 - Explain the rationale behind the use of the bag of...Ch. 26 - Prob. 6EQCh. 26 - Take a look at question 2 in More Genetic TIPS...Ch. 26 - All of the homeotic genes inDrosophilahave been...Ch. 26 - Prob. 9EQCh. 26 - wo techniques commonly used to study the...Ch. 26 - Prob. 11EQCh. 26 - Prob. 12EQCh. 26 - 13. Another way to study the role of proteins...Ch. 26 - 14. Why have geneticists used reverse genetics to...Ch. 26 - Prob. 1QSDCCh. 26 - Prob. 2QSDCCh. 26 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following best describes the concept of cell differentiation during the development of a multicellular organism? A. During development, all of the genes in the embryo's cells are expressed at first, but fewer and fewer are expressed as time proceeds. B. During development, different sets of genes are deleted from different cell types so that at the end of development, each cell has only the genes it needs. C. During development, different cells become specialized to have different phenotypes even though they all originated from the same cell. ..arrow_forwardYou inject bicoid MRNA into the posterior end of a fertilized fruit fly egg just prior to the first cleavage. How will the experiment affect Hox gene expression in this fly? How will it affect the fly embryo's anatomy? Explain your answer, demonstrating your understanding of the role bicoid and Hox genes play in development.arrow_forwardProtein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene in yeast is always producing mRNA, but the Gcn4 protein is only made when the cells are starved. What does this mean for diagnostic techniques that try to look at gene expression?arrow_forward
- At the molecular level, how do you think a gain-of-function mutation in a developmental gene might cause it to be expressed in the wrong place or at the wrong time? Explain what type of DNA sequence would be altered.arrow_forwardProgesterone is a steroid hormone (also described as a ligand) that prepares the body for pregnancy. It binds to the progesterone receptor (PR) protein in the cytoplasm of various cells. Ligand bound PR acts as a transcriptional activator, binds to the DNA in the promoter region of several genes and leads to transcriptional activation of these genes. Which of the following statements must be true for the PR protein? O Ligand binding to the PR results in a conformational change in the primary structure of the protein The domain/region of the PR protein that interacts with the DNA, has basic amino acids Ligand binding to the PR results in a conformational change in the tertiary structure of the protein The domain/region of the PR protein that interacts with the DNA, has acidic amino acidsarrow_forwardAfter graduating from UNC Charlotte with the BS in Biology, you get a job with an agro-chemical company and are assigned to a lab that is exploring the use of a newly synthesized compound that may be a possible insecticide. The compound is thought to control insect populations by disrupting the genes that control embryonic development. Your lab conducts an experiment to investigate the influence of the compound on developmental genes by measuring the levels of the proteins the genes code for. You measure protein levels in two groups of insect eggs: the Treatment Group, which is exposed to the compound, and the Control Group, which is exposed to a compound that is known to have no negative effects on gene activity. Your results are shown below. In all graphs, the Control group exhibits normal levels of proteins and gene expression. (Remeber: P > 0.05 means the observed differences are not significant; P < 0.05 means the differences are significant and biologically meaningful).…arrow_forward
- After graduating from UNC Charlotte with the BS in Biology, you get a job with an agro-chemical company and are assigned to a lab that is exploring the use of a newly synthesized compound that may be a possible insecticide. The compound is thought to control insect populations by disrupting the genes that control embryonic development. Your lab conducts an experiment to investigate the influence of the compound on developmental genes by measuring the levels of the proteins the genes code for. You measure protein levels in two groups of insect eggs: the Treatment Group, which is exposed to the compound, and the Control Group, which is exposed to a compound that is known to have no negative effects on gene activity. Your results are shown below. In all graphs, the Control group exhibits normal levels of proteins and gene expression. (Remeber: P > 0.05 means the observed differences are not significant; P < 0.05 means the differences are significant and biologically meaningful).…arrow_forwardAfter graduating from UNC Charlotte with the BS in Biology, you get a job with an agro-chemical company and are assigned to a lab that is exploring the use of a newly synthesized compound that may be a possible insecticide. The compound is thought to control insect populations by disrupting the genes that control embryonic development. Your lab conducts an experiment to investigate the influence of the compound on developmental genes by measuring the levels of the proteins the genes code for. You measure protein levels in two groups of insect eggs: the Treatment Group, which is exposed to the compound, and the Control Group, which is exposed to a compound that is known to have no negative effects on gene activity. Your results are shown below. In all graphs, the Control group exhibits normal levels of proteins and gene expression. (Remeber: P > 0.05 means the observed differences are not significant; P < 0.05 means the differences are significant and biologically meaningful).…arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
- Discuss the role of homeotic genes in development. Explain what happens to the phenotype of a fruit fly when a gain-of-function mutation in a homeotic gene causes the protein to be expressed in an abnormal region of the embryo. What are the consequences of a loss-of-function mutation in such a gene?arrow_forwardDystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79 exons. The mature mRNA measures 14,000 and codes for a protein with 3,685 amino acids. Abnormal expression of dystrophin leads to severe symptoms like muscle weakness and fatigability, a disease that is called muscular dystrophy. Most patients with muscular dystrophy become wheelchair dependent early in life. Cardiac muscle is also affected which results typically in premature death (~ second or third decade of life). Several mutations in this gene have led to the production of low levels of dystrophin or of a defective,…arrow_forwardYou observe that a particular gene is being transcribed during development. How can you tell whether the expression of this gene is under transcriptional or translational control?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY