(a)
To determine: The eight possible codons that are represented by
Introduction: Nirenberg and Matthaei used RNA (Ribose
(b)
To determine: The eight possible codons which would be expected among 64 codons represented by nucleotide sequences of resulting copolymers in incubation mixture A and B.
Introduction: Nirenberg and Matthaei used RNA (Ribose nucleic acid) homopolymers and copolymers which were synthesized by polynucleotide phosphorylase. This enzyme is responsible for adding random nucleotides to the growing polypeptide chain. In this case, two polynucleotide phosphorylase incubations mixture were used. Incubation mixture A and B differ in the concentration of UTP and CTP by three times.
(c)
To determine: The expected frequency of occurrence of possible amino acids in polypeptides that are obtained from the translation of copolymers from incubation mixture A and B.
Introduction: Nirenberg and Matthaei used RNA (Ribose nucleic acid) homopolymers and copolymers which were synthesized by polynucleotide phosphorylase. This enzyme is responsible for adding random nucleotides to the growing polypeptide chain. In this case, two polynucleotide phosphorylase incubations mixture were used. Incubation mixture A and B differ in the concentration of UTP and CTP by three times.
(d)
To determine: The information that can be obtained by the technique of copolymer analysis.
Introduction: Nirenberg and Matthaei used RNA (Ribose nucleic acid) homopolymers and copolymers which were synthesized by polynucleotide phosphorylase. This enzyme is responsible for adding random nucleotides to the growing polypeptide chain. In this case, two polynucleotide phosphorylase incubations mixture were used. Incubation mixture A and B differ in the concentration of UTP and CTP by three times.
(e)
To determine: Whether or not codons with two uracils and 1 cytosine can encode phenylalanine, leucine, and serine.
Introduction: Nirenberg and Matthaei used RNA (Ribose nucleic acid) homopolymers and copolymers which were synthesized by polynucleotide phosphorylase. This enzyme is responsible for adding random nucleotides to the growing polypeptide chain. In this case, two polynucleotide phosphorylase incubations mixture were used. Incubation mixture A and B differ in the concentration of UTP and CTP by three times.
(f)
To determine: That which of the three codons among UUC, UCU, and CCU having two uracils and one cytosine will correspond to amino acids serine, leucine, and phenylalanine.
Introduction: Nirenberg and Matthaei used RNA (Ribose nucleic acid) homopolymers and copolymers which were synthesized by polynucleotide phosphorylase. This enzyme is responsible for adding random nucleotides to the growing polypeptide chain. In this case, two polynucleotide phosphorylase incubations mixture were used. Incubation mixture A and B differ in the concentration of UTP and CTP by three times.
(g)
To determine: The way by which codons UUC, UCU, and CCU can be assigned to appropriate amino acids among serine, leucine, and phenylalanine.
Introduction: Nirenberg and Matthaei used RNA (Ribose nucleic acid) homopolymers and copolymers which were synthesized by polynucleotide phosphorylase. This enzyme is responsible for adding random nucleotides to the growing polypeptide chain. In this case, two polynucleotide phosphorylase incubations mixture were used. Incubation mixture A and B differ in the concentration of UTP and CTP by three times.
Want to see the full answer?
Check out a sample textbook solutionChapter 18 Solutions
Becker's World of the Cell (9th Edition)
- BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: 1. Use the following base sequence of one strand of an AATTGAACACATGCGCCC. imaginary DNA molecule: 2 Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. 3. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. 4. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. 5. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step 4 mRNA from Step 5…arrow_forwardRNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…arrow_forwardThe subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motifarrow_forward
- Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forwardUsing Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.arrow_forwardAnswer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Metarrow_forward
- You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forward. The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. .AUAUAUAUAUAUAU-. What polypeptide would you expect to be produced? Precisely what information would this give you about the code?arrow_forwardPart II: Information Transfer Background Information - Key Points The background information provided for this lab has given you a general overview of some of 24 the key terms and definitions necessary to understand the transfer of information from gene to protein. The information included below will help you work through the specific problems included in your Tutorial 4 Assignment. When working on the problems remember the base mu to pairing rules (Table 3). Table 3: Rules for nucleotide base pairing. cytosine (C) - guanine (G) adenine (A)- thymine (T) DNA RNA For Transcription: ● ● ● ● cytosine (C) - guanine (G) adenine (A)- uracil (U) Initiation is determined by the recognition of the promoter sequence in the DNA by the RNA polymerase. Stef The transcription start site is downstream of the promoter and is designated as the +1 site. Aspartic acid Alanina Valine Arginine Serine Lysine Asparagine Glutamic TEOPO|0C|AGUCAG|UC|AG/DCAG/3G/ CAGUC UGU A C A Threonine G Methionine Isoleucine…arrow_forward
- Translation in prokaryotes: Does the initiation of translation in prokaryotes rely on initiation factors to bind to the Shine-Dalgarno site for it to start?arrow_forwardA cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.arrow_forwardTranslation work is an essential step for protein synthesis. In order for the protein to be synthesized what must be recognized first in translation? How does this important part in translation have an effect on the rest of the reaction? Please provide a valid argument. Be as detailed as possible.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning