cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.

Q: Please help me with this. *Also Please Note: This is ONE problem set and according to the policy,…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: True or False. Explain. A) At no time during protein synthesis does an amino acid make direct…

A: Nucleic acid is a type of macromolecule present inside the nucleus of cell which is involved in…

Q: Product(wrong) Substrate(wrong) Ku+ nil Ꮩw . IVW Pre-translocation ky+ ky+ KIV+ / niv Err* k₁. ky-nG…

A: High fidelity gene transcription and replication require kinetic discrimination of nucleotide…

Q: You discovered a halophilic bacterium and want to characterize the mechanism involved in producing…

A: The tRNA (transfer RNA) takes part in polypeptide synthesis by bringing in the amino acid to the…

Q: Briefly, be able to define each of these AND, where relevant, tell what do they do, and which…

A: As per our guideline we are allowed to answer only starting three.  Please repost the other.

Q: The Cystic Fibrosis receptor (CFTR) is a transmembrane protein that functions as an ion channel…

A: The compartment where Delta 508 mutation occurs that leads to folding defect in CFTR.  This causes a…

Q: Matching type: Choose the effect of the given agents to translation or transcription  Choices: RNA…

A: Transcription and translation are the processes by which a gene can express itself in the form of…

Q: Give 3 advantages of enzyme induction and repression in bacterial systems.

A: Enzyme induction refers to the rise within the quantity of accelerator supermolecule as a results of…

Q: How a glycoprotein is translated, modified and ultimately transported to the outer plasma membrane.…

A: Cells communicate with each other via released proteins unique to each kind. Signal transduction…

Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…

A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…

Q: Charging of tRNA requires ATP Aminoacyl tRNA Synthase Amino Acid All of the Above

A: Amino acid activation which is also known as aminoacylation or tRNA charging refers to the…

Q: ndicate whether each of the following statements are true of depurination, deamination or pyrimidine…

A: DNA is a long polymer of nucleotide. A nucleotide is made ip of sugar, nitrogenous bases, and…

Q: Identify all enzymes used with their corresponding function in the phases of translation of…

A: The central dogma is a process where a flow of genetic information is conducted from DNA to RNA.…

Q: EUKARYOTIC RNA POLYMERASES Based on their elution order from ion-exchange chromatography…

A: Eukaryotic RNA polymerase :  In eukaryotic cells we can find three different types of RNA…

Q: Question 18 4) Listen The transcription complex includes a localed on the DNA, that assist to find…

A: Transcription is the process by which cell makes an RNA copy of a piece of DNA.  mRNA carries…

Q: Actinomycin D inhibits DNA-dependent RNA synthesis. This antibiotic is added to a bacterial culture…

A: Antibiotics are isolated from microorganisms (bacteria). They use antibiotics to inhibits the growth…

Q: How has the mutation altered the polypeptide? Is the function of the hemoglobin molecule (which…

A: Sickle cell disease is a blood disorder characterized by sickle shaped RBCs which has got less…

Q: Genes involved in DNA to protein route are highly conserved in comparison to genes of enzymes that…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. DNA used as…

Q: The genetic code is both universal and degenerate. Explain how these aspects are an advantage, but…

A: Proteins are made up of amino acids encoded by codons. Each codon consist of three nucleotide which…

Q: Parts A-C in the table show the genotypes for two partial diploid strains of the lac operon. Gene…

A: A group of genes called the lac operon are involved in the bacterial metabolism of lactose. *Three…

Q: None

A: The provided diagram represents an mRNA molecule transcribed from an operon, a typical feature in…

Q: Some transcription factors contain bromodomains. Explain the function of the bromodomain?

A: Transcription factors are responsible for intiating the transcription process. The transcript…

Q: TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle…

A: There are many biomolecules present in an organism and each biomolecule has a specific role.…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: The binding specificity of σ subunit of RNA polymerase is dependent on DNA sequence.

A: Introduction The RNAP σ(Sigma) Subunit Is Involved In All Steps Of Transcription Initiation, As Well…

Q: Explain why lysozyme cleaves the artifi cial substrate (NAG)4 ~4000 times more slowly than it…

A: Lysozyme is a naturally occurring enzyme found in bodily secretions such as tears, saliva and milk.…

Q: true or false 1.) The unique stem-loop structures of the transfer RNA helps the RNA perform its…

A: The cells have DNA within the nucleus. The DNA replicates itself to form identical copies during…

Q: Mutations and DNA repair. Francis Crick's "wobble pairing" hypothesis suggested an economical…

A: The process by which the information coded in RNA (mRNA) is decoded into a polypeptide is one of the…

Q: Drug 2-Lumacaftor (VX-809): In people with the most common CF mutation, F508del, a series of…

A: This mutation occurs in the gene cystic fibrosis transmembrane conductance regulator (CFTR).

Q: You plate colonies of E. coli with the lac operon an unknown genotype on 1) a medium containing only…

A: The operon is the prokaryotic gene regulatory mechanism that is responsible for the regulation of…

Q: Why is the ErbB family pathway an important pathway for researchers that target cancer therapy.…

A: Numerous human cancers are thought to be caused by aberrant activation of the ErbB family of…

Q: (iii) Mark all sentences as true or false. (A) RNA polymerase binds to the operator sequence of the…

A: RNA polymerase is defined as the enzyme that catalyzes the transcription of DNA into RNA. It is a…

Q: The Shine-Dalgarno sequence binds to sequence within the large ribosomal subunit so that ribosomes…

A: in order to address the question, we'll first weigh out each option to arrive at the correct option.…

Q: Please answer this question. I mainly want part A, but if you could answer part B as well, I would…

A: Transcription is the process of formation of mRNA from DNA molecule.  Translation is the process of…

Q: Transcription in eukaryotes requires which of the following? Choose ALL that apply. the protein…

A: The genes are hereditary units in living organisms. They carry specific functions or…

Q: Which of the following events has nothing to do with the mechanism known as "RNA interference"? Q a…

A: RNA interference means the silencing of the genes or gene expression is suppressed. RNA interference…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…

A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…

Q: True or False. 1. a.) RNA polymerase decodes mRNA so the ribosome can make proteins. b.) Only…

A: The DNA is the genetic material that is present in the organisms like humans. The central dogma of…

Q: Lac operon explain in easy words

A: An operon is a genetic regulatory system that clusters genes coding for functionally related…

Q: Primary secondary and tertiary structure of trna l shaped structure is in? What is a benign…

A: Introduction :- A benign neoplasm, also known as a benign tumor, is a mass of abnormal cells that…

Q: Explain how plasma membrane proteins that start to be translated in the cytosol are then targeted to…

A: Many proteins that are destined to be part of the plasma membrane are initially synthesized in the…

Q: Human cells are highly resistant to transformation. Experiments have shown that 5 regulatory…

A: Proteins are the important macromolecules in the body that helps in functioning of varieties of…

Q: Human histone H1 protein has the protein sequence as shown as “KKASKPKKAAS-…

A: Histone H1 protein K in the sequence represents lysine The given histone sequence is rich in lysine…

Q: Draw the mechanism of action of an HIV protease. Label the substrate, the intermediates, and the…

A: HIV protease catalyzes peptide bond hydrolysis of proteins by using water. The enzyme has two…