Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 18.12PS
Cloning Conundrum. Using established recombinant DNA technology, you insert a gene from a human liver cell into a bacterium. The bacterium then expresses a protein corresponding to the inserted DNA. To your dismay, you discover that the protein produced is useless and is found to contain many more amino acids than does the protein made by the eukaryotic cell. Assuming there is no mutation in the human gene, explain why this happened.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
please help me with thi question.
What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA?
The options are attached. Multiple answers can be chosen
please help me with this question.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5
determine what amino acid will be formed from the given DNA strand below:
3’ T A C A T G C C G A A T G C C 5’
Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. Partner DNA strand
2. the mRNA strand
3. The tRNA
4. the formed amino acids
5. the discussion of the entire procedure
Chapter 18 Solutions
Becker's World of the Cell (9th Edition)
Ch. 18 - Suppose a triplet on the template strand of a...Ch. 18 - Of these three techniques, which one provides the...Ch. 18 - Compare and contrast bacterial and eukaryotic...Ch. 18 - The autoimmune disease systemic lupus...Ch. 18 - QUANTITATIVE Triplets or Sextuplets? In his Nobel...Ch. 18 - The Genetic Code in a T-Even Phage. A portion of a...Ch. 18 - Frameshift Mutations. Each of the mutants listed...Ch. 18 - Prob. 18.4PSCh. 18 - Locating Promoters. The following table provides...Ch. 18 - Prob. 18.6PS
Ch. 18 - Starting Up. Refer to Figure 18-30, which depicts...Ch. 18 - RNA Processing. The three major classes of RNA...Ch. 18 - Prob. 18.9PSCh. 18 - Antibiotic Inhibitors of Transcription. Rifamycin...Ch. 18 - Prob. 18.11PSCh. 18 - Cloning Conundrum. Using established recombinant...Ch. 18 - Nucleoli. Indicate whether each of the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- organisms ha varieties. Through this process, several genetically (10) been produced. What I Can Do Activity 7: MATCHY MATCHY Direction: Match the purpose to the components found in the box below. Antibiotic Resistance Gene Multiple Cloning Site Promoter DNA Inserted Gene Sequence Multiple Cloning Site 1. Allows the controlled expression of the desired gene in the presence of an inducing agent (e.g., beta-galactosidase; heat treatment (~65°"C) 2. DNA sequence or portion for the insertion of the desired gene. This section may contain sequences that will be cut by specific restriction endonucleases ( cuts within the molecule) 3. Successful insertion of a gene allows the expression of its protein product. This usually provides a specific trait to the "transformed" bacteria. 4. Provides a way to screen a population of bacteria for those that took up the plasmid. For example, if an ampicillin resistance gene is encoded in the plasmid, then only bacteria 10 t4arrow_forwardTrue or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forwardPick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.arrow_forward
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forward8 points total. Within the general field of biotechnology, DNA technology uses modern laboratory techniques for the studying and manipulation of genetic material. Explain how DNA might be sequenced, analyzed, and "cut and pasted" as DNA technology is employed. In addition, outline one way in which DNA technology could be employed to improve human lives. I 3arrow_forward
- RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forwardMutation: Thiamine Dimers A. what is a mutagen or cellular process that leads to this mutation? B. If the nucleotide excision repair pathway is not functional, is there another pathway or mechanism for preparing this mutation? if so, what is the pathway/mechanism? C. what is the consequence of this mutation if it is not repaired before DNA is replicated to make the next generation of cells?arrow_forward
- Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardChain termination/Nonsense mutation - no a.a. that corresponds to a new base sequence; results to the appearance of nonsense codon DNA Sequence : TGG GTC CGG CCC AAT 3. What is the new DNA sequence and the corresponding new amino acid sequence When there is a T-substitution in the 14th N-base?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License