Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 18.7PS
Starting Up. Refer to Figure 18-30, which depicts a typical prokaryotic gene, for this problem. The sequences labeled as regions A–D include both strands over the area highlighted.
- (a) Which region of the DNA sequence will most likely be transcribed into RNA?
- (b) What sequence will the predicted transcript begin with?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
I am more confused. how about we start from begining, you post answers on here, and then we go from there?
1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.
2. "Look carefully at the DNA sequence and identify the start site for transcription"
3.
Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence.
Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein).
Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…
Translation. Write the anti-codon sequence of the MRNA transcript. Translate the
MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter
abbreviation.
ANTI-CODON
3'
5'
SEQUENCE
AMINO ACID
N-
C-
SEQUENCE (3 letter terminus
Abbreviation)
Terminus
AMINO ACID
N-
C-
SEQUENCE (1 letter terminus
Abbreviation)
Terminus
Part I. Structure-Function Relationships in Genes
1. Consider the "two-line model" of a gene shown below - each line represents one
strand of a DNA double helix, and the transcription start site is indicated as +1. Use the
two-line models provided when answering the following questions.
3'
5'
+1
Assume that you know RNA polymerase will move to the right during transcription.
On the diagram above, do the following:
• Label "upstream" and "downstream" on this gene
• Label where you would find the promoter
min
I
• Draw a box where you would expect to find the TATA box
• Draw a third line below the model representing the RNA transcript (label the
ends!)
• Label one of the DNA strands as the template strand
3'
2. Now, let's try that again! This time assume that you know RNA polymerase will move
to the left during transcription. Repeat the same tasks as before on the diagram below:
5'
5'
3'
+1
I
I
5'
3'
Chapter 18 Solutions
Becker's World of the Cell (9th Edition)
Ch. 18 - Suppose a triplet on the template strand of a...Ch. 18 - Of these three techniques, which one provides the...Ch. 18 - Compare and contrast bacterial and eukaryotic...Ch. 18 - The autoimmune disease systemic lupus...Ch. 18 - QUANTITATIVE Triplets or Sextuplets? In his Nobel...Ch. 18 - The Genetic Code in a T-Even Phage. A portion of a...Ch. 18 - Frameshift Mutations. Each of the mutants listed...Ch. 18 - Prob. 18.4PSCh. 18 - Locating Promoters. The following table provides...Ch. 18 - Prob. 18.6PS
Ch. 18 - Starting Up. Refer to Figure 18-30, which depicts...Ch. 18 - RNA Processing. The three major classes of RNA...Ch. 18 - Prob. 18.9PSCh. 18 - Antibiotic Inhibitors of Transcription. Rifamycin...Ch. 18 - Prob. 18.11PSCh. 18 - Cloning Conundrum. Using established recombinant...Ch. 18 - Nucleoli. Indicate whether each of the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forward. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forwardAAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forward
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardOpen reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationarrow_forwardYou continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forward
- protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of Gene Y is necessary for Gene Ys function. a. Liver: Functional Gene Y; Brain: Functional Gene Y b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Yarrow_forwardRNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…arrow_forwardComplements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forward
- Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequencearrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forward(5) AAG a. What is indicated by label (2) in the figure above? b. What is indicated by label (3) in the figure above? c. What is the function of part d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that will recognize all the codons for this amino acid in (c).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY