4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? · 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' 4c. What are the first 5 amino acids encoded by this gene? available at the beginning of this exam. Note - there is a codon table N' C'

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: . Determine how many amino acids will appear on the protein encoded in a DNA segment that contains…

A: 2.  DNA SEGMENT CONTAINS = 981 NUCLEOTIDE UNITS. on transcription of DNA segment which contains 981…

Q: 8. The following diagram represents the Christmas-tree-like structures during transcript On the…

A: E. Eliminators are viewed downstream of the quality as deciphered, and ordinarily happen…

Q: 1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of…

A: the answers to these multiple-choice questions are given below.

Q: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a…

A: The genetic material of a cell, that is, the DNA (deoxyribonucleic acid) contain various genes that…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: 3. You have assembled a very short contig below, but you don’t know if this is the sense or…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: 6. Let us suppose that a vertebrate organism carries a mutation that causes some cells that normally…

A: Introduction: DNA methyltransferase is a group of enzymes that transfers the active methyl group…

Q: 24. Use the table below to answer the following question. The template strand of a gene contains…

A: The DNA molecules are double stranded in structure . The DNA structure undergoes the process of…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…

A: DNA to mRNA is transcription and mRNA to protein is translation.

Q: 5. The pioneering work of Paul Berg, Herbert Boyer, and Stanley Cohen in the early 1970s led to the…

A: Insulin, a peptide hormone produced by the β-cells of the pancreas and is a regulatory hormone for…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G…

A:

Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…

A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…

Q: 30  A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: GivenA DNA sequence encoding a five-amino acid…

Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…

A: Fidelity of replication is the most important for the very existence of an organism. Besides its…

Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…

A: Mutations are changes that occurs in nucleotide sequence of DNA.The types of mutation are:…

Q: 6. Assume that you are working at a biotechnology company and you are assigned to a project in which…

A: Protein purification is a set of procedures for isolating a single or a few proteins from a…

Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…

A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…

A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…

Q: iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Promoter sequence is present in the DNA at the upstream of regulatory gene.

Q: 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell…

A: * Sickle cell anemia is blood disorder in which red blood cells becomes mis shapen and turns into…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid…

A: We'll answer the first question since the exact one is not specified. Please submit a new question…

Q: 4. The gene for B-galactosidase has 3,075 bp. How long would it take for the E. coli RNA polymerase…

A: Transcription is the process by which the information stored in DNA is transferred onto an RNA…

Q: III. Discuss the following aspects of translation: 1. How does the location and timing of…

A: According to our guideline we can answer maximum 3 subparts of a question. So, you need to upload…

Q: Why is yeast rna is insoluble in cold water, ethanol, diluted hydrochloric acid?

A: Nucleic acids  are of two types: RNA and DNA  RNA  It is referred to as ribonucleic acid. It is…

Q: 8 QUESTION: Transcribe the gene. Write out the correct sequence of mRNA bases. Notice that this is…

A: Transcription is the synthesis of RNA from DNA segment with the help of RNA polymerase enzyme. It…

Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu

Q: Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is…

A: RNA editing is a process of modification, in which nucleotide sequences are changed within an RNA.

Q: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial…

A: # According to our guidelines we can answer only first 3 subparts or in case of short type questions…

Q: b. FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5'…

A: Introduction :- When an RNA transcript is first produced in a eukaryotic cell, it is referred to as…

Q: 5) Interpreting Data: For the following question, consider the table and graph presented below. p24…

A: The Ziehl-Neelson (ZN) stain is the most commonly utilized of the different types of AF staining…

Q: 2. In the given segment in problem 1, illustrate and indicate the direction of synthesis of: a.…

A: The replication process begins with the unwinding of the polynucleotide strand, which forms a…

Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…

A:

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA  is as follows_  3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: 13. In your own words, identify one of the reasons why it is difficult to assemble a genome and…

A:

Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…

A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…

Q: 1. A DNA base sequence transcribed into messenger RNA in the following sequence:…

A: Introduction :- Transcription is the process through which synthesis of mRNA molecules takes place ,…

Q: 8. Please describe an experiment to determine if the amino acid sequence PKWKAAV can serve as a…

A: A nuclear localization signal (NLS) is an amino acid sequence that 'marks' a protein for nuclear…

Q: 22. Which of the following mutations would be expected to have the most harmful effect on the…

A: Mutations Mutations are defined as any change or alteration in the base sequences of the DNA further…

Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…

A: Reversion mutation is one that causes such a change in the gene that does not cause change in…

Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…

A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…

Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme…

A: The restriction site is the site which is a type of specific genetic sequence present on the DNA…

Q: 3A. Were the effects of this mutation, beneficial, harmful, or neutral? Justify your position based…

A: Answer: Mutation = These are the changes occured in the nucleotide sequence of a DNA which can be…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.