Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 18, Problem 18.3PS
Frameshift Mutations. Each of the mutants listed below this paragraph has a different mutant form of the gene encoding protein X. Each mutant gene contains one or more
(a) −
(b) −/+
(c) −/−
(d) +/−/+
(e) +/−/+/−
(f) +/+/+
(g) +/+/−/+
(h) −/−/+/−/−
(i) −/−/−/−/−/−
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
Alpha polypeptide (ADH1A).
Give a detailed description of its role in the disease. Describe the impact of the disease on society.Describe a way in which your gene can be manipulated to treat the disease. Assume you can make any changes to the protein product and describe specifically how it will affect its interaction with other molecules.
Leaderless. The MRNA for the A repressor begins with 5'-AUG-3',
5'-AUG-3', which encodes the methionine residue that begins the
protein. What is unusual about this beginning? Would it cause the
MRNA to translate efficiently or not?
Chapter 18 Solutions
Becker's World of the Cell (9th Edition)
Ch. 18 - Suppose a triplet on the template strand of a...Ch. 18 - Of these three techniques, which one provides the...Ch. 18 - Compare and contrast bacterial and eukaryotic...Ch. 18 - The autoimmune disease systemic lupus...Ch. 18 - QUANTITATIVE Triplets or Sextuplets? In his Nobel...Ch. 18 - The Genetic Code in a T-Even Phage. A portion of a...Ch. 18 - Frameshift Mutations. Each of the mutants listed...Ch. 18 - Prob. 18.4PSCh. 18 - Locating Promoters. The following table provides...Ch. 18 - Prob. 18.6PS
Ch. 18 - Starting Up. Refer to Figure 18-30, which depicts...Ch. 18 - RNA Processing. The three major classes of RNA...Ch. 18 - Prob. 18.9PSCh. 18 - Antibiotic Inhibitors of Transcription. Rifamycin...Ch. 18 - Prob. 18.11PSCh. 18 - Cloning Conundrum. Using established recombinant...Ch. 18 - Nucleoli. Indicate whether each of the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardQuestion 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forward
- Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forwardPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardTranslation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) Terminusarrow_forward
- proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forwardplease help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- I am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forwardtRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of the tRNA b. Always recognizes only one specific tRNA c. Recognizes all tRNA molecules d. Forms an ester linkage between the amino acid and the tRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY