Concept explainers
(a)
To determine: Whether snRNA (small nuclear ribose
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(b)
To determine: Whether spliceosome used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(c)
To determine: Whether snRNP (small nuclear ribonucleoprotein) used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(d)
To determine: Whether splice sites used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
(e)
To determine: Whether lariat used in the splicing process is a protein, RNA, or both.
Introduction: Splicing is a mechanism in which processing of primary transcripts of RNA (Ribose nucleic acid) takes place. In this process, introns (non-coding regions) are spliced out from primary transcripts by cleavage at some conserved sequences that are called splice sites.
Want to see the full answer?
Check out a sample textbook solutionChapter 18 Solutions
Becker's World of the Cell (9th Edition)
- Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardLeaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forward
- tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of the tRNA b. Always recognizes only one specific tRNA c. Recognizes all tRNA molecules d. Forms an ester linkage between the amino acid and the tRNAarrow_forwarde.) ( acid buffer an appropriate choice? Why or why not? If I need to perform an enzymatic reaction at pH 6.5, is a citric )Describe the process of transcription in as much detail as possible using pictures and words beginning with a paired (duplexed) strand of DNA and ending with a processed mRNA which is ready for translation. 7.arrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forward
- An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardHello , please help me with this question. I am struggling with naming the Amino Acid sequence from the RNA sequence . thank you ,arrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forward
- Question 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forwardPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardInitiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl TRNA c. N-formylmethionyl tRNA d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA „N10arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education