The subunits of the translation initiation complex in PROKARYOTES. * O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55
Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…
A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…
Q: 97 Which of the following is examples of a transposable element found in bacteria? (multiple choice…
A: Note- we are supposed to answer three question according to our guidelines, please repost other…
Q: Prokaryotic cells can have more than one functional start codon per MRNA because O prokaryotic…
A: Start codon is present as the first codon which initiates the translation process. Start codon is…
Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…
A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…
Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…
A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…
Q: Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio…
A: The codon for alanine is either GCG or GCC The ratio of C to G is 3:1 For GCC the ratio will be…
Q: spings gating its gen ISlation from this organism and use it to translate (in a test tube) some RNA…
A: The nucleotide in a DNA is a group which is arranged in a linear sequence in a DNA which contains…
Q: Arrange the following components of translation in the approximate order in which they would appear…
A: In prokaryotes, the protein synthesis takes place in the cytoplasm. It comprises two steps…
Q: Some DNA polymerases have proofreading activities. After a nucleotide is added to a growing nucleic…
A: Ribosomes also have similar proofreading activities during translation. The proofreading activity…
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: There are different types of mutations, that result in a change or no change in the protein…
Q: Different sigma factors in E. coli cells share Select one: O a. same core RNA polymerase O b. same…
A: 7.) Answer is option c
Q: True or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein…
A: DNA is a self-replicating molecule. The enzyme involved in the self-replication of DNA is DNA…
Q: A portion of prokaryotic mRNA has the following base sequence: 5'ACAUCUAUGCCACGA3'. Which of the…
A: The given m RNA sequance will help in synthesis of the protien by the process of Translation .
Q: Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio…
A: RNA is single-stranded and it contains the C and G in the ratio of 3:1 ratio. RNA is composed of…
Q: A mutation called base substitution mutation had been altered the sequence in a. eliminated the…
A: Base substitution is a type of mutation in which one nucleotide base is substituted by the other and…
Q: Drag the functions involved in the bacterial translation process into the appropriate box with the…
A: IF1 Answer : Prevents entry of an amino acyl trna into the ribosomeA site during the early initial…
Q: There are three termination codons (UAA, UAG, UGA) but usually only one initiation codon (AUG) is…
A: The initiation codon is also referred to as start codon which marks the beginning of the translation…
Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…
A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…
Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…
A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…
Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…
A:
Q: 37 Transposons in eukaryotes are mechanistically different from bacterial transposons. Yes or no…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Matching type. Match column A with column B. Your answer in column B should be matched with column…
A: Molecular biology has become the most recent tool added to the study of genetics. It provides…
Q: TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle…
A: There are many biomolecules present in an organism and each biomolecule has a specific role.…
Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…
A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…
Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.
A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…
Q: Briefly outline the similarities and the differences you expect to see between prokaryotic and…
A: The translation is a process through which polypeptides are synthesized. It is the final step of…
Q: With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere…
A: A cell "reads" the information in a messenger RNA (mRNA) during translation and uses it to create a…
Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…
A: The replication, transcription and translation are the very important processes in cell biology that…
Q: Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed…
A: The peptide bond is also similar to an amide bond that helps to join two amino acids and make a…
Q: The antibacterial protein colicin E3 is an effective inhibitor of protein synthesis in bacteria.…
A: Colicins are produced by some strains of E. coli that carries colicinogenic plasmid having genetic…
Q: The antibacterial protein colicin E3 is an effective inhibitor of pro- tein synthesis in…
A: It is given that the protein colicin E13 is an effective inhibitor of the protein synthesis in…
Q: Using the provided čoding strand below 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the anticodons…
A: DNA is two stranded ladder like structure which comprises of :- A) Coding strand B) Template…
Q: The antibacterial protein colicin E3 is an effective inhibitor of protein synthesis in bacteria.…
A: Colicin E3 has a bactericidal effect. It is made and released by E.coli cells to act on other E.coli…
Q: b. FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5'…
A: Introduction :- When an RNA transcript is first produced in a eukaryotic cell, it is referred to as…
Q: ou are a bacteriologist studying a pathogenic protein (the “BAD” protein) that contributes to…
A: B -Asx A - alanine D =Asprtic acid a. K - b. D Lysine - Aspartic acid AAA, AAG - GAT, GAC
Q: n prokaryotes, transcription and translation occur ________. simultaneously simultaneously in…
A: Transcription is the process of copying a segment of DNA to make an RNA copy. The RNA formed is…
Q: Transcribe and translate the following sequence of DNA: ATGAAGTTACCC. There is a mutation that…
A: Transcription is the synthesis of pRNA with the template DNA. Translation is the synthesis of…
Q: In Figure 9-17, what do you think happens next to theribosomal subunits after they are finished…
A: To form a particular amino acid chain, or polypeptide, messenger RNA (mRNA) is decoded in a ribosome…
Q: UCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Post translational modifications – what are they and what do they do? (In terms of translation)
A: Post translational modification refers to the covalent and and enzymatic modification of proteins…
Q: Questión 15 The following statements best describes the RNA structure EXCEPT A it is usually single…
A: Answer : Option D is correct. - according to the question asked above, option (d) cannot describe…
Q: After translation (post-translation), eukaryotic proteins can be modified by: O a acetylation. Ob.…
A: Post-translation means translation products are modified by the addition of chemical groups to the…
Q: Using the table on the other page- transcribe the RNA sequence into codons and their amino acids:…
A: Given: Codons are given, have to tell which amino acid they code for. DNA => transcription =>…
Q: You want to translate a polycistronic bacterial MRNA in eukaryotic cells. You remove all stop codons…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single…
A: Genetic code is read in the form of triplets.so first we will convert these to 3 codes and then…
Q: Posttranslational modifications of proteins do not include: peptide bond formation glycosylation…
A: Proteins are one of the essential biomolecules for life. These are formed by translation from the…
Q: The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode…
A: The C-terminal residue in a peptide is one that has a free carboxyl group or does not acylate…
Q: 16. Translation codon termination in eukaryotes all except: B. UGA A. UAC C. UAG D. UAA
A: introduction Translation is the process of creating polypeptides from an mRNA transcript that was…
Q: Explain translation termination and re-initiation and they are similar and different in bacteria and…
A: Translation has three main stages: initiation, elongation, and termination. in prokaryotes,…
Step by step
Solved in 2 steps
- why the Shine–Dalgarno sequence is important to prokaryotes？State the bases of prokayotes’ mRNAThe following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
- The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stopMolecular Besigns Large Ribosomal Subunit Translation of RNA into Proteins Small Ribosomal Subunit N-terminus Protein Exit Channel Ⓡ Met Methionine Met tRNA In which active site of the Ribosome is that tRNA found? A site P site Estie Ribosome 5 Adenine Uracil Guanine Cytosine RNA Hydrophobic Hydrophilic Negative 444 3.3- 3366 Positive Amino Acids CysteineWrite the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- Which of the following statements about the post-translation modification of proteins by phosphorylation are true? Check all that apply it is usually reversible it is an important mechanism for regulating enzyme activity it changes a hydroxyl group to a phosphate group it is a modification of the R groups of proline (P), isoleucine (I) and glycine (G) 18 2 # 3 $ 4 % 5 MacBook Pro 6 v Ro 8 9 0Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit
- Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letterAGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine QApply What You've Learned - Mutations cont. Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND POSITION THIRD POSITION UU UCU UAU UGU Phenylalanine UUC Cysteine Tyrosine UC UAC UGC Serine UA UCA UAA Stop UGA Stop Leucine UG UCG UAG Stop UGG Tryptophan CUU CCU CAU CGU Histidine CÚC CC CÁC CGC Leucine Proline Arginine CỦA CCA CAA CGA Glutamine CUG CG CAG CGG AUU AUC Isoleucine ACU AAU AGU Asparagine Serine ACC AAC AGC Threonine AUA ACA AAA AGA Lysine Arginine AUG Methionine Start ACG AAG AGG GUU GCU GAU GGU Aspartate GÚC GCC GAC GGC Valine Alanine Glycine GUA GCA GAA GGA Glutamate GUG GCG GAG GGG Original DNA DNA TACGCTAT GAGC Protein Methionine-Arginine-Tyrosine-Serine Mutation #2 DNA TACGCTAC GA G C What effect did it have on the protein produced? (you will need to complete transcription and translation to answer the question) O The amino acid was changed to a stop code which shortened the protein. Thymine was replaced by a cytosine. O…
