Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 18.10PS
Antibiotic Inhibitors of Transcription. Rifamycin and actinomycin D are two antibiotics derived from the bacterium Streptomyces. Rifamycin binds to the β subunit of E. coli RNA polymerase and interferes with the formation of the first phosphodiester bond in the RNA chain. Actinomycin D binds to double-stranded DNA by intercalation (slipping between neighboring base pairs).
(a) Which of the four stages in transcription would you expect rifamycin to primarily affect?
(b) Which of the four stages in transcription would you expect actinomycin D to primarily affect?
(c) Which of the two inhibitors is more likely to affect RNA synthesis in cultured human liver cells?
(d) Which of the two inhibitors would be more useful for an experiment that requires the initiation of new RNA chains to be blocked without interfering with the elongation of chains that are already being synthesized?
(e) When fertilized sea urchin eggs are treated with actinomycin D, they develop for many hours but eventually arrest as hollow balls of several hundred cells (called blastulae). Propose an explanation for why such embryos arrest, but also why they progress as far as they do.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
E32. In the technique of DNase I footprinting, the binding of a protein
to a region of DNA protects that region from digestion by DNase I
by blocking the ability of DNase I to gain access to the DNA. In
the DNase I footprinting experiment shown here, a researcher
began with a sample of cloned DNA 400 bp in length. This DNA
contained a eukaryotic promoter for RNA polymerase II. The
assembly of general transcription factors and RNA polymerase II
at the core promoter is described in Chapter 12 (see Figure 12.14).
For the sample loaded in lane 1, no proteins were added. For the
sample loaded in lane 2, the 400-bp fragment was mixed with
RNA polymerase II plus TFIID and TFIIB.
2
400
350
250
175
50
Which region of this 400-bp fragment of DNA is bound by RNA
polymerase II and TFIID and TFIIB?
||
III ||| | ||||
I am more confused. how about we start from begining, you post answers on here, and then we go from there?
1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.
2. "Look carefully at the DNA sequence and identify the start site for transcription"
3.
Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence.
Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein).
Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…
Hi, help please.
Which of the following is TRUE regarding RNA editing?
a .The coding sequence is altered in the chromosome
b. More than one answer choice is correct
c. The mRNA is altered by Guide RNAs
d. Translation first takes place, following by altering of the coding sequence
Chapter 18 Solutions
Becker's World of the Cell (9th Edition)
Ch. 18 - Suppose a triplet on the template strand of a...Ch. 18 - Of these three techniques, which one provides the...Ch. 18 - Compare and contrast bacterial and eukaryotic...Ch. 18 - The autoimmune disease systemic lupus...Ch. 18 - QUANTITATIVE Triplets or Sextuplets? In his Nobel...Ch. 18 - The Genetic Code in a T-Even Phage. A portion of a...Ch. 18 - Frameshift Mutations. Each of the mutants listed...Ch. 18 - Prob. 18.4PSCh. 18 - Locating Promoters. The following table provides...Ch. 18 - Prob. 18.6PS
Ch. 18 - Starting Up. Refer to Figure 18-30, which depicts...Ch. 18 - RNA Processing. The three major classes of RNA...Ch. 18 - Prob. 18.9PSCh. 18 - Antibiotic Inhibitors of Transcription. Rifamycin...Ch. 18 - Prob. 18.11PSCh. 18 - Cloning Conundrum. Using established recombinant...Ch. 18 - Nucleoli. Indicate whether each of the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardMatching type: Choose the effect of the given agents to translation or transcription Choices: RNA polymerase II inhibition Prevention of ribosomal movement in eukaryotes RNA polymerase inhibition Disruption of elongation stage of translation Prevention of ribosomal movement in prokaryotes Disruption of initiation stage of translation 1. Amanitin 2. Tetracycline 3. Diphtheria toxin 4. Rifampicin 5. Puromycinarrow_forwardYou continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forward
- Consider an animal. During DNA replication, all base pairs of DNA are copied. But, during transcription, only some of the DNA bases are transcribed. What parts of the DNA or/and protein(s) determines which part of the genome is transcribed into mRNA? (short answer)arrow_forwardTranscription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNAarrow_forwardRow A B. C D Process 1 transcription transcription translation Protein Synthesis in an Animal Cell Select the row below that correctly identifies the name of Process 1 as well as a sequence that could represent Structure 1. Sequence of Structure 1 CGA ATT GTA CAA CGA AUU GUA CAA CGA ATT GTA CAA CGA AUU GUA CAA translation Structure 1 Process 1 Structure 2 ORA Process 2arrow_forward
- Part I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardMolecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…arrow_forwardRNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…arrow_forward
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)arrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardComplements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY