Concept explainers
(a)
To determine: Whether the given statement about RNA polymerases, “The enzyme is insensitive to alpha-amanitin” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of
(b)
To determine: Whether the given statement about RNA polymerases, “The enzymes catalyze an exergonic reaction” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(c)
To determine: Whether the given statement about RNA polymerases, “All the primary transcripts must be processed before being used in translation” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(d)
To determine: Whether the given statement about RNA polymerases, “The enzymes may sometimes be found attached to an RNA (Ribose nucleic acid) molecule that also has ribosomes bound to it” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(e)
To determine: Whether the given statement about RNA polymerases, “The enzymes synthesize ribosomal RNA” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(f)
To determine: Whether the given statement about RNA polymerases, “Transcription factors must bind to the promoter before the polymerase can bind” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(g)
To determine: Whether the given statement about RNA polymerases, “The enzyme adds a poly (A) sequence to messenger RNA” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(h)
To determine: Whether the given statement about RNA polymerases, “The enzyme moves along the DNA template strand in 3' to 5' direction” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(i)
To determine: Whether the given statement about RNA polymerases, “The enzyme synthesizes a product likely to acquire a 5' cap” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(j)
To determine: Whether the given statement about RNA polymerases, “All promoters used by the enzyme lie mostly upstream of the transcriptional start site and are only partially transcribed” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
(k)
To determine: Whether the given statement about RNA polymerases, “The specificity of transcription by the enzyme is determined by a subunit of the holoenzyme” is true for bacterial, polymerase I, II, or III enzymes.
Introduction: Transcription is a process by which RNA is formed from information stored in the form of nucleotide bases in DNA (Deoxyribose nucleic acid). Three types of RNA polymerase enzymes are used in the case of eukaryotic transcription. These RNA polymerases are RNA polymerase I, II, and III. Only one type of RNA that is known as bacterial RNA polymerase is used in prokaryotic cells.
Want to see the full answer?
Check out a sample textbook solutionChapter 18 Solutions
Becker's World of the Cell (9th Edition)
- Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationalearrow_forwardTranslation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) Terminusarrow_forwardBroken operators. Consider a hypothetical mutation in OR2OR 2 that blocks both A repressor and Cro binding. How would this mutation affect the likelihood of bacteriophage entering the lytic phase?arrow_forward
- Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forwardPlease select appropriate word in each bracket Many anti-cancer drugs affect nucleotide metabolism and inhibit DNA synthesis. For example, a widely used anti-cancer agent, 5-fluorouracil, is a pyrimidine analog that is incorporated into nucleotide form and affects DNA synthesis by inhibiting the activity of [ Select ] ["thymidine kinase", "ribunucleotide reductase"] , the enzyme required to synthesize [ Select ] ["dTMP", "dUMP"] . This inhibition of DNA replication affects both cancer and normal cells, and hence there are serious side effects of these agents including [ Select ] ["immune system suppression", "hyperallergenic reaction"] and damage to the [ Select ] ["lining of the GI tract", "connective tissue of cartilage"] . Methotrexate, was the first drug to actually cure a cancer, choriocarcinoma, in 1958, and serves to block the activity of [ Select ] ["dihydrofolate reductase", "serine hydroxymethyl-transferase"] , another enzyme required for the synthesis of dTMP.arrow_forwardPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forward
- Part I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardInitiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl TRNA c. N-formylmethionyl tRNA d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA „N10arrow_forwardA cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.arrow_forward
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardTranscription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNAarrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning