Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 8CONQ
Together with a specific set of proteins, snoRNAs direct the methylation or pseudouridylation of rRNAs. Does the snoRNA function as a scaffold, guide, ribozyme, blocker, decoy, and/or alterer of protein function or stability?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which type of snoRNA causes an rRNA to be methylated?
Match the following list of RNAs (left side) with their function(s) (right side).
mRNA i. block translation of elected mRNAs
rRNA ii. modification and processing of rRNA
snoRNA iii. modification of snoRNA and snRNA
snRNA iv. components of ribosome
tRNA v. spilicing of RNA transcripts
scaRNA vi. directs degradation of selected mRNAs
miRNA vii. codes for proteins
siRNA viii. adaptor for protein synthesis
(
Explain the function of spliceosomes in eukaryotic cells.
The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and
spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the
sequence of the mature MRNA after splicing? [
5' AUGGGUUUAGGACCCCCGAUAAA 3'
Chapter 17 Solutions
Genetics: Analysis and Principles
Ch. 17.1 - Which of the following can bind to ncRNAs? a. DNA...Ch. 17.1 - 2. When an ncRNA functions as a decoy, it
a....Ch. 17.1 - Prob. 3COMQCh. 17.2 - 1. Which of the following functions does HOTAIR...Ch. 17.3 - 1. The process of RNA interference may lead to
a....Ch. 17.3 - 2. In catalyzing the methylation or...Ch. 17.4 - 1. Which of the following is a function of SRP?...Ch. 17.5 - 1. Which of the following components are needed...Ch. 17.5 - 2. In the CRISPR-Cas system, what does the...Ch. 17.5 - Which of the following is a function of the...
Ch. 17.6 - Prob. 1COMQCh. 17.6 - Let's suppose that the overexpression of a...Ch. 17 - 1. List and briefly describe four types of...Ch. 17 - 2. An ncRNA may have the following functions:...Ch. 17 - 3. What is meant by the term RNA world? Describe...Ch. 17 - Explain how HOTAIR plays a role in the...Ch. 17 - What is the phenomenon of RNA interference (RNAi)?...Ch. 17 - With regard to RNAi, what are three possible...Ch. 17 - 7. What is the difference between an miRNA and an...Ch. 17 - Together with a specific set of proteins, snoRNAs...Ch. 17 - Describe the structure of SRP in eukaryotes, and...Ch. 17 - Look at Figure 17.6 and predict what would happen...Ch. 17 - Compare and contrast the roles of crRNA and...Ch. 17 - In the CRISPR-Cas system, does the tracrRNA act as...Ch. 17 - Prob. 13CONQCh. 17 - Outline the steps that occur when piRISCs silence...Ch. 17 - List five types of cancer in which ncRNAs can be...Ch. 17 - Prob. 16CONQCh. 17 - A protein called trypsin, which plays a role in...Ch. 17 - Prob. 2EQCh. 17 - Prob. 3EQCh. 17 - As described in Chapter 21, the CRISPR-Cas system...Ch. 17 - Prob. 5EQCh. 17 - Prob. 6EQCh. 17 - Prob. 1QSDCCh. 17 - Go to the PubMed website and do a search using the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcription in eukaryotes requires which of the following in addition to RNA polymerase? Choose all that apply A) ribsomes and tRNAs B) start and stop codons C) several transcription factors D) DNA nucleotides E) Aminoacyl-tRNA synthetase F) RNA nucleotides .arrow_forwardWhat is its functional difference with the RNA polymerases found in both eukaryotic and prokaryotic cells?arrow_forwardAn rRNA binds to a snoRNP that contains a C/D box snoRNA.What type of covalent modification would you expect this rRNA toundergo? Would it be methylated or pseudouridylated, or both?arrow_forward
- Explain how snoRNAs direct covalent modifications to rRNAs.arrow_forwardBreast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine residue in the transcribed protein. How will this mutation effect this protein? a) Polarity before and after mutation: b) Size of the region before and after the mutation: c) Tertiary interaction you would expect with substrate: d) Name an amino acid that the unaffected protein's methionine could interact:arrow_forwardConsider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…arrow_forward
- The RNAi and the microRNA (miRNA) pathways share many components and characteristics. What unique feature distinguishes the microRNA pathway from RNAi? a) only the RNAi pathway is initiated by dsRNA molecules b) the miRNA pathway does not require Dicer c) the miRNA pathway does not require RISC. d) miRNAs have 100% complementarity with their mRNA targets to block translation e) siRNAs that act in RNAi have 100% complementarity with their mRNA targets resulting in endonucleolytic cleavagearrow_forwardATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM proteinarrow_forwardBriefly describe the role of the following RNAS: (i) IncRNA (ii) miRNAarrow_forward
- a) The deacetylation of histones generally causes gene inactivation. True or false? b)During eukaryotic translation, the first contact between the ribosome and the mRNA is usually made when the small ribosomal subunit directly binds to the translational start site (Kozak sequence) on the mRNA. True or false? c)The termination of translation is carried out by a single tRNA molecule that recognizes all three stop codons. True or false? d) The deamination of cytosine, which produces uracil, is less likely to be repaired, compared to the deamination of 5-methylcytosine, which produces thymine.True or false? e)An HLH-bHLH heterodimer can bind DNA. True or false? F)Chromatin remodeling complexes posseses ATPase activity. True or false? g)Histone methylation generally causes gene inactivation. True or false? h) A pre-mRNA is cleaved downstream of its polyA signal before the transcription terminates. True or false? i) During X chromosome inactivation in female mammals, most genes are repressed…arrow_forward1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence, transcribe this gene i.e a) write out that sequence of the mRNA you will make from turning on this gene Z b) Label the 5' and 3' ends of the mRNA made 2) Assuming there is a ribosome binding site for the mRNA you just synthesized in the previous question, write out the amino acid sequence of this protein Z that is made (Using the genetic discord Mary provided) The following double stranded DNA sequence provided contains a gene for making proteins Z. The regulatory sequence or switch is indicated by the Red colored sequences. Start of transcription is 10 nucleotide after the switch sequence beginning at the Blue region. Answer the following questions. 3'. TATGACAACGCGTATAATCCAGTCGGTTTGGGGGTAATTGGGCGTCCTACGTCTACAAAGGGTCGTT ААТAGCATTTAGGCGTсTGCCTTTTAТCGTTTATCGAATTтсТТАТTАTTTTAATстCсT...5 5'.ATACTGTTGCGCATATTAGGTCAGCCAAACCCCCATTAACCCGCAGGATGCAGATGTTTCCCAGCAAT…arrow_forwardWhich among A - D is false regarding antisense RNAS? A) O they occur in protein coding genes B) O they only affect expression of the protein coding genes in which it resides C) O they bind to mRNA D) O they act as translational control mechanism E) Onone are false, A -D are all truearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY