Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17.5, Problem 3COMQ
Which of the following is a function of the piRISC?
a. Inhibits transcription of TEs
b. Causes the degradation of TE RNA
c. Causes chromosome breakage
d. Both a and b
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Transcription factors
a. help the RNA polymerase bind DNA
b. are involved in chromatin remodeling, uncoil the DNA
c. modulate transcription from the distance
d. add the 5’ CAP to the RNA
Assembly of transcription initiation complexes is mainly controlled by?
a.
Promotors
b.
Activators
c.
Repressors
d.
Suppressors
e.
B & C
A transcription factor (protein - orange/green) is bound to a promoter of a gene (DNA - blue) it regulates. What changes would result in the gene not being expressed?
A. Mutations in the DNA sequence where the TF is bound
B. Mutations in the DNA binding domain of the TF
C. Mutations in the 3’UTR (untranslated region) of this gene
A and B only
B and C only
A, B, and C
Chapter 17 Solutions
Genetics: Analysis and Principles
Ch. 17.1 - Which of the following can bind to ncRNAs? a. DNA...Ch. 17.1 - 2. When an ncRNA functions as a decoy, it
a....Ch. 17.1 - Prob. 3COMQCh. 17.2 - 1. Which of the following functions does HOTAIR...Ch. 17.3 - 1. The process of RNA interference may lead to
a....Ch. 17.3 - 2. In catalyzing the methylation or...Ch. 17.4 - 1. Which of the following is a function of SRP?...Ch. 17.5 - 1. Which of the following components are needed...Ch. 17.5 - 2. In the CRISPR-Cas system, what does the...Ch. 17.5 - Which of the following is a function of the...
Ch. 17.6 - Prob. 1COMQCh. 17.6 - Let's suppose that the overexpression of a...Ch. 17 - 1. List and briefly describe four types of...Ch. 17 - 2. An ncRNA may have the following functions:...Ch. 17 - 3. What is meant by the term RNA world? Describe...Ch. 17 - Explain how HOTAIR plays a role in the...Ch. 17 - What is the phenomenon of RNA interference (RNAi)?...Ch. 17 - With regard to RNAi, what are three possible...Ch. 17 - 7. What is the difference between an miRNA and an...Ch. 17 - Together with a specific set of proteins, snoRNAs...Ch. 17 - Describe the structure of SRP in eukaryotes, and...Ch. 17 - Look at Figure 17.6 and predict what would happen...Ch. 17 - Compare and contrast the roles of crRNA and...Ch. 17 - In the CRISPR-Cas system, does the tracrRNA act as...Ch. 17 - Prob. 13CONQCh. 17 - Outline the steps that occur when piRISCs silence...Ch. 17 - List five types of cancer in which ncRNAs can be...Ch. 17 - Prob. 16CONQCh. 17 - A protein called trypsin, which plays a role in...Ch. 17 - Prob. 2EQCh. 17 - Prob. 3EQCh. 17 - As described in Chapter 21, the CRISPR-Cas system...Ch. 17 - Prob. 5EQCh. 17 - Prob. 6EQCh. 17 - Prob. 1QSDCCh. 17 - Go to the PubMed website and do a search using the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwardWhich of the following is not true regarding gene regulation that involves DNA bending? a. The precise distance between the regulatory sequence and the promoter is important. b. Effect can be to repress transcription c. Effect can be to activation transcription d. Regulated genes can be thousands of base pairs away from the regulatory sitesarrow_forwardWhich statement/s is/are TRUE about transcription?A. During transcription, DNA polymerase binds to RNA and separates the DNA strands.B. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA.C. RNA polymerase binds only to DNA promoters, which have specific base sequences.D. Promoters are signals in RNA that indicate to RNA polymerase where to begin transcription.E. Transcription occurs in the 3’ to 5’ direction with respect to the growing mRNA strand.arrow_forward
- How can Cas9 technology be used in gene therapy. A. Base editing can be used to repair DNA error B. All 3 answers C. Cas9 can be used to activate transcription of a gene D. Knocking out a gene if it’s gain a function mutation is the cause of the diseasearrow_forwardWhat is the direction of the growth of newly synthesized RNA chain during transcription? options: A. 5'-to-3' direction. B. 3'-to-5' direction. C. Both A and B D. Neither A nor Barrow_forwardWhich of these BEST DESCRIBE tryptophan in the Trp Operon? A. Acts as a corepressor B. Acts as a coactivator C. Acts as an inducer D. Acts as an enhancerarrow_forward
- Which of the following is a function of the piRISC?a. Inhibits transcription of TEsb. Causes the degradation of TE RNAc. Causes chromosome breakaged. Both a and barrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardWhich of the following statements is INCORRECT? a. In simultaneous transcription of mRNA, many messenger RNA may be transcribed from different DNA strand happening all at once. b. All of the following statements are incorrect c. A poly A - tail is added at the end of the 3’ base. d. In eukaryotic cells, messenger RNA must exit the nucleus and enter the cytoplasmarrow_forward
- Which of the following may produce more than one functional protein from an mRNA transcript?a. chromatin condensation b. transcriptional regulation c. epigeneticsd. alternative mRNA processingarrow_forwardWhich of the following decrease gene activity? a. acetylation of histone proteins b. methylation of histone proteins c. methylation of cytosines in DNA d. all the above decrease gene activityarrow_forwardWhich of the following is the action of SnRNA (snurps)? a. Knocks out a portion of the gene b. Splices the introns out of m-RNA c. Splices out the exons out of m-RNA d. Important in growth and developmentarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY