Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine residue in the transcribed protein. How will this mutation effect this protein? a) Polarity before and after mutation: b) Size of the region before and after the mutation: c) Tertiary interaction you would expect with substrate:

Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginine residue in the transcribed protein. How will this mutation effect this protein? a) Polarity before and after mutation: b) Size of the region before and after the mutation: c) Tertiary interaction you would expect with substrate:

Name: Breast cancer can be caused by a genetic mutation on the BRCA1 gene c
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Breast cancer can be caused by a genetic mutation on the BRCA1 gene changing a methionine to an arginineresidue in the transcribed protein. How will this mutation effect this protein?a) Polarity before and after mutation:b) Size of the region before

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
6. Given: 3"--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is the sequence of amino acids in the protein coded by the MRNA? c) If the first G is substituted by A, what is the sequence of amino acids in the protein? d) What type of mutation is illustrated by (e)?
CH3 D) H,N-CH-c-o CH, CH-CH3 13. A silent mutation does not change the protein that is produced. B) has a very minor change on the protein produced (ie, Glu to Asp). C) has a major change on the protein produced (ie, Glu to Val) causes protein synthesis to stop due to a stop codon. A) D) 14. Which amino acid sequence is coded for from DNA with the coding strand sequence 5' AAG GCT AGT GGC 3'? A) Thr-His-Asn-Asp Gly-Ser-Ala-Lys B) Lys-Ala-Ser-Gly C) Asp-Asn-His–Thr D)
For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the ribosome. b) The tRNA is the same thing as the amino acid. c) There are two binding pockets within the ribosome where different tRNAs will bind to the mRNA. d) The first codon that is recognized by the ribosome is UAG e) The ribosome can bind to the mRNA in any location.
A membrane-associated protein kinase has the sequence -GMCLVS at its C-terminus, which has been shown by mutagenesis to be essential for its biological function and sub cellular location.a) What is the most likely post-translational modification that this motif would be susceptible to?b) How is this modification introduced to the protein?c) What is the likely effect of this modification on the behaviour of the protein?d) What other modification to N-terminus of the protein might achieve a similar effect on the behaviour of the protein?
Each type of molecule listed below is recognized by a specific class of nuclear import receptor (importin) or nuclear export receptor (exportin). For each type of molecule, state whether you think it is recognized by an importin or exportin and explain why (in terms of where that molecule is synthesized, what that molecule does, and where it does it). (a) RNA polyermase II: (b) ribosomal protein: (iii) †RNA:
1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also charged methionine tRNAs with alanine? b)What would happen if an individual was homozygous for mutant alleles of the gene encoding the aminoacyl tRNA synthetase responsible for charging leucine tRNAs?
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.
1) Define the following terms as they relate to protein synthesis (translation). A) initiation B) elongation C) termination 2) Given the following coding strand sequence of DNA, what is the template strand sequence? 5'-ATGCGCTGAC-3' 3) Given the following coding strand sequence of DNA, what is the corresponding mRNA sequence? 5'-ATGCGCTGAC-3' 4) Use the genetic code and translate the following DNA coding strand sequence. 5' ATG ATA AAT ACC TAG 3' 5) Introduce a mutation to the DNA sequence and describe its effect on the protein sequence. 1 1
A polypeptide has the following sequence: Phe-Pro-Lys-Gly. Which of the following sequences in the coding strand of the DNA could code for this peptide? Select all that are correct. A) CTT-GGG-AAA-CCC-TAG B) TTC-CCG-AAG-GGA C) TTT-CCC-AAA-GGG-TGA D) UUC-CCA-AAG-GGU E) TTC-CCA-AAG-GGC F) AAA-GGG-TTT-CCC-ATT
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien