A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8     Given the location and type of the mutation, why would scientists potentially be concerned about this variant?

Q: B14. The last two amino acids added to a polypeptide are - Trp - Glu - (C terminus). The last two…

A: To determine the last two anticodons used in the translation of the given polypeptide sequence, we…

Q: includes

A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…

Q: As part of a project investigating potential new drug targets in the fight against malaria, you are…

A: Introduction:-  Truncation of protein:- is meant by the proteolysis or structural gene manipulation…

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5' 1. Determine the sequence…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…

A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…

Q: Write the detail or exact information of the following of molecule “X” with UniProtKB accession…

A: Hello, thank you for your question. As per our guidelines, I am answering only the first three…

Q: Consider the structure of Cro repressor protein from bacteriophage lambda B. It is a DNA binding…

A: The bacteriophage lambda contains the regulatory protein known as CRO repressor. Escherichia coli…

Q: Some mutations affect changes in protein structure and function that can result in disease whereas…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…

Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…

A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: Transfer RNA (tRNA) molecules contain a sequence of three nucleotides known as the anticodon. It is…

Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain

A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…

Q: Gene editing is also used to explore the structure and function ofproteins. For example, changes can…

A: From the observations, it gets clear that the amino acid aspartate shows the most functional…

Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…

A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…

Q: Although the Shine-Dalgarno sequences vary considerably in differ- ent genes, they include examples…

A: Introduction: The small piece of DNA that code for protein referred as genes. It is the functional…

Q: that the

A: Polypeptides, or proteins, are chemical compounds composed up of amino acids. They're big,…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: What naturally found amino acyl tRNA synthetase can be used to attach 2-aminobutyric acid to a tRNA?…

A: Higher living beings vary in their ability to synthesize the 20 common amino acids. Most bacteria…

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…

A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…

Q: A short protein segment was cleaved by two different enzymes resulting in two sets of degradation…

A: Edman degradation is a method in which amino acids can be sequenced in a peptide. At first the amino…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: This figure comes from an article about predicting protein structures with a multiplayer online ame…

A: Based on the figure and the descriptions you have provided, here is a summary of the trends and…

Q: . A geneticist examined the amino acid sequence of aparticular protein in a variety of E. coli…

A: Base substitution is a type of mutation in which a single nucleotide is affected. It is caused by…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…

A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…

Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…

A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…

Q: The antibacterial protein colicin E3 is an effective inhibitor of protein synthesis in bacteria.…

A: Colicin E3 has a bactericidal effect. It is made and released by E.coli cells to act on other E.coli…

Q: Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of…

A: Thalassemias are hereditary blood diseases in which hemoglobin synthesis is reduced. Thalassemias…

Q: Human ribonucleotide reductase has two allosteric sites, the S site and the A site. What is the…

A: Human ribonucleotide reductase in a mammalian enzyme that is responsible for the conversion of RNA…

Q: UCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…