A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8     Given the location and type of the mutation, why would scientists potentially be concerned about this variant?

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence so that the…

Q: Ornithine is structurally similar to lysine except ornithine’s side chain is one methylene group…

A: Ornithine plays important role in urea cycle. Ornithine is structurally similar to lysine except…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of…

A: The probability that a protein molecule is completely error free is (1-δ)n, where n is the number of…

Q: What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.   a. Class…

A: An enzyme that synthesizes tRNAs by amino acid polymerization is called an aminoacyl-tRNA synthetase…

Q: The effect of base-pair substitution mutations on protein function varies widely from no detectable…

A: A mutation is any alteration in the nucleotide sequence that changes the sequence of DNA, RNA and…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: The disease cystic fibrosis is the result of a mutation in the gene that encodes the cystic fibrosis…

A: A codon is a DNA or RNA trinucleotide sequence encoding a particular amino acid or signaling the…

Q: Select one: O Met-Cys-Ala-Thr-Tyr---- O Met-Cys-Cys-Thr-Tyr--- O Met-Ala-Ala-Thr-Tyr---- O…

A: Aminoacyl tRNA synthetase are enzymes of extreme importance during the process of protein synthesis…

Q: Many blood clotting proteins undergo a post-translational modification in which specific glutamic…

A: Post Translational Modifications (PTM) of such complexity is only observed in eukaryotes and not in…

Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…

A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the…

A: Chromatography is a useful technique to study the separation of amino acids. Paper chromatography is…

Q: e nucleotide sequence of this anticodon loop under tant tRNA will, a) Recognize GCC as the codon for…

A: tRNA refers to transfer RNA. It helps in decoding an mRNA sequence into a protein. Three nucleotides…

Q: Where would you find the base pairs that constitute the promoter? h. Which intron interrupts the 3′…

A: Base pairs that constitute the promoter are located at the 5' end of the UTR region. Promoter are…

Q: You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this…

A: The functional properties of the new protein, has two amino acid changes—namely, a surface Phe…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: This figure comes from an article about predicting protein structures with a multiplayer online ame…

A: Based on the figure and the descriptions you have provided, here is a summary of the trends and…

Q: HbS results from the substitution of valine forglutamic acid at the number 6 position in the b…

A: HbS is the result of a single base-pair mutation in the gene responsible for the beta-globin chain…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…

A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…

Q: Figure 2 illustrates a type of gene mutation.     a) State the type of gene mutation shown in…

A: Mutation  Mutation is the alteration in the original sequence of DNA. Mutation can be caused due to…

Q: You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this…

A: pI of protein is directly proportional to the pKa of amino acids.