Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 30ESP
Consider the drawing of a dinucleotide below.
- (a) Is it DNA or RNA?
- (b) Is the arrow closest to the 5′ or the 3′ end?
- (c) Suppose that the molecule was cleaved with the enzyme spleen phosphodiesterase, which breaks the covalent bond connecting the phosphate to C-5′. After cleavage, to which nucleoside is the phosphate now attached (A or T)?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5'
A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps.
B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each.
C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’
1. What type of point mutation is it?
2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
In the diagram of DNA at the right:
a) fill in the letters representing the bases on the right-hand strand.
b) How many nucleotides are shown? 6
c) Explain why these two strands are described as "anti-parallel."
because two stands in apposite directions
d) If the DNA strand on the left is the coding strand, what mRNA
sequence would be transcribed from it?
ACG
e) What amino acid would that mRNA strand code for? (read the
letters from top to bottom)
(The) threonine
2'
1'
2
AT
बबब
GH C
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
Chapter 11 Solutions
Concepts of Genetics (12th Edition)
Ch. 11 - In the Meselson-Stahl experiment, which of the...Ch. 11 - An alien organism was investigated. When DNA...Ch. 11 - Why might mutations in genes encoding telomerase...Ch. 11 - Although the brother is an immunologically matched...Ch. 11 - Prob. 3CSCh. 11 - HOW DOWE KNOW? In this chapter, we focused on how...Ch. 11 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 11 - Compare conservative, semiconservative, and...Ch. 11 - Describe the role of 15N in the MeselsonStahl...Ch. 11 - Predict the results of the experiment by Taylor,...
Ch. 11 - What are the requirements for in vitro synthesis...Ch. 11 - In Kornbergs initial experiments, it was rumored...Ch. 11 - How did Kornberg assess the fidelity of DNA...Ch. 11 - Which characteristics of DNA polymerase I raised...Ch. 11 - Kornberg showed that nucleotides are added to the...Ch. 11 - What was the significance of the polA1 mutation?Ch. 11 - Summarize and compare the properties of DNA...Ch. 11 - List and describe the function of the ten subunits...Ch. 11 - Distinguish between (a) unidirectional and...Ch. 11 - List the proteins that unwind DNA during in vivo...Ch. 11 - Define and indicate the significance of (a)...Ch. 11 - Outline the current model for DNA synthesis.Ch. 11 - Why is DNA synthesis expected to be more complex...Ch. 11 - Suppose that E. coli synthesizes DNA at a rate of...Ch. 11 - Several temperature-sensitive mutant strains of E....Ch. 11 - While many commonly used antibiotics interfere...Ch. 11 - Describe the end-replication problem in...Ch. 11 - Many of the gene products involved in DNA...Ch. 11 - In 1994, telomerase activity was discovered in...Ch. 11 - The genome of D. melanogaster consists of...Ch. 11 - Prob. 26ESPCh. 11 - DNA polymerases in all organisms add only 5...Ch. 11 - Assume that the sequence of bases shown below is...Ch. 11 - Reiji and Tuneko Okazaki conducted a now classic...Ch. 11 - Consider the drawing of a dinucleotide below. (a)...Ch. 11 - To gauge the fidelity of DNA synthesis, Arthur...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 5'--TTAATGGGACAGCTTGTGTAGAGG--3' a.) What is the complementary strand of DNA? b.) What is the transcribed mRNA sequence? c.) What is the amino acid sequence translated from the strand of mRNA synthesized inarrow_forwardLocate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.arrow_forwardGiven the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'arrow_forward
- Helicases are crucial to many of the molecular biological processes we have learned about in this class. Briefly (2-3 sentences max), describe what a helicase does and give 2 examples of different processes (replication, repair, transcription, and translation) that helicases are involved in what it does in each process. A) What does a helicase do? B) Example 1 C) Example 2arrow_forwardA segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardHow does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.arrow_forward
- TRUE OR FALSE a) The 2 chains composing one double helix run in opposite directions; they are antiparallel (one is 5’->3’ and the other 3’->5’). b) DNA molecules can perform their function in replication and transcription as long as the hydrogen bonds between the bases remain intact.arrow_forwardThe following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.arrow_forwardA solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.arrow_forward
- a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What nitrogenous bases would be found on "the other DNA strand lying alongside of it?" b) Which nitrogenous bases would be found on the MRNA (Messenger RNA) transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC?arrow_forwardA DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine, guanine, and thymine). (a) How many DNA sequences are exactly 24 letters long? (b) Given a DNA sequence of length 24, how many single letter mutations are possible? (c) Given a DNA sequence of length 24, how many double letter mutations are possible?arrow_forwardWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY