Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 25ESP
The genome of D. melanogaster consists of approximately 1.7 × 108 base pairs. DNA synthesis occurs at a rate of 30 base pairs per second. In the early embryo, the entire genome is replicated in five minutes. How many bidirectional origins of synthesis are required to accomplish this feat?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation.
a) List all the steps from cell pellet preparation to DNA elution.
b) With which feature can the membrane in the column that comes with the commercial kit bind DNA?
c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?
In yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose what would happen to the telomeres over time in a yeast lineage in which the following mutations were created.
a) The gene encoding the catalytic subunit of the telomerase is deleted.
b) What happens to the yeast telomeres over time if the telomerase RNA retains the same anchor but is altered in its templating region?
a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences.
b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.
Chapter 11 Solutions
Concepts of Genetics (12th Edition)
Ch. 11 - In the Meselson-Stahl experiment, which of the...Ch. 11 - An alien organism was investigated. When DNA...Ch. 11 - Why might mutations in genes encoding telomerase...Ch. 11 - Although the brother is an immunologically matched...Ch. 11 - Prob. 3CSCh. 11 - HOW DOWE KNOW? In this chapter, we focused on how...Ch. 11 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 11 - Compare conservative, semiconservative, and...Ch. 11 - Describe the role of 15N in the MeselsonStahl...Ch. 11 - Predict the results of the experiment by Taylor,...
Ch. 11 - What are the requirements for in vitro synthesis...Ch. 11 - In Kornbergs initial experiments, it was rumored...Ch. 11 - How did Kornberg assess the fidelity of DNA...Ch. 11 - Which characteristics of DNA polymerase I raised...Ch. 11 - Kornberg showed that nucleotides are added to the...Ch. 11 - What was the significance of the polA1 mutation?Ch. 11 - Summarize and compare the properties of DNA...Ch. 11 - List and describe the function of the ten subunits...Ch. 11 - Distinguish between (a) unidirectional and...Ch. 11 - List the proteins that unwind DNA during in vivo...Ch. 11 - Define and indicate the significance of (a)...Ch. 11 - Outline the current model for DNA synthesis.Ch. 11 - Why is DNA synthesis expected to be more complex...Ch. 11 - Suppose that E. coli synthesizes DNA at a rate of...Ch. 11 - Several temperature-sensitive mutant strains of E....Ch. 11 - While many commonly used antibiotics interfere...Ch. 11 - Describe the end-replication problem in...Ch. 11 - Many of the gene products involved in DNA...Ch. 11 - In 1994, telomerase activity was discovered in...Ch. 11 - The genome of D. melanogaster consists of...Ch. 11 - Prob. 26ESPCh. 11 - DNA polymerases in all organisms add only 5...Ch. 11 - Assume that the sequence of bases shown below is...Ch. 11 - Reiji and Tuneko Okazaki conducted a now classic...Ch. 11 - Consider the drawing of a dinucleotide below. (a)...Ch. 11 - To gauge the fidelity of DNA synthesis, Arthur...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?arrow_forwardYou conducted an experiment to determine the mechanism of DNA replication in the hypothetical organism Fungus mungus. Your data shows that synthesis of newly replicated DNA from F. mungus is discontinuous on both strands of the replication fork. Does this result support or not support the hypothesis that F. mungus replicates its DNA by the same mechanism as yeast? Briefly explain your answer.arrow_forward22. Duplication of artificial chromosomes in yeast requires the presence of sequences derived from the yeast telomere region. Under which of the following circumstances might chrome duplication proceed in the absence of a telomere? A) Additional origin of replication is included B) Chromosome is circular C) Enhancer region is included D) Origin of replication is deleted E) Yeast cells are deficient in telomerasearrow_forward
- Detailed study of the monster Lochnessius coolnameii revealed the following: Characteristic Result Size of nuclear genome 2.04 m of DNA (B-form) Length of mitotic S phase 5 hr Rate of DNA synthesis 2,500 basepairs/min at each replication fork What is the minimum number of origins of replication needed in each cell of this monster?arrow_forwardXeroderma pigmentosum is a genetic disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by ultraviolet light. Studies have shown that it can result from mutations in any one of seven genes. What can you infer from this finding? A) There are seven genes that produce the same protein B) These seven genes are the most easily damaged by ultraviolet light. C) There are seven enzymes involved in the nucleotide excision repair process. D) These mutations have resulted from translocation of gene segments.arrow_forwardWhich of the following is NOT correct concerning the initiation of replication in E. coli? Question 29 options: A) It involves a region of the DNA called oriC. B) DnaA proteins bind to the DNA to begin separation of the strands. C) The strands are initially separated at GC-rich regions of DNA. D) Following initial separation, enzymes continue to separate the parental DNA strands around the rest of the chromosome.arrow_forward
- Suppose that E. coli synthesizes DNA at a rate of 100,000 nucleotides per minute and takes 40 minutes to replicate its chromosome. (a) How many base pairs are present in the entire E. coli chromosome? (b) What is the physical length of the chromosome in its helical configuration—that is, what is the circumference of the chromosome if it were opened into a circle?arrow_forwardIn yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose what would happen to the telomeres over time in a yeast lineage in which the following mutations were created. a) The gene encoding the catalytic subunit of the telomerase is deleted. b) The template portion of the telomerase RNA is changed from 5’-ACACCCACA to 5’-ACAUCUACA.arrow_forwardWhat percentage of the DNA sites in yeast are accessible, assuming that the fraction of sites observed for GAL4 is typical? To how many base pairs of the 12-Mb yeast genome does this percentage correspond?arrow_forward
- There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forwardFigure 3: Restrictrion site map showing the following: A) linear DNA that is not cut as reference B) DNA cut with BamHI, C) DNA cut with EcoRI, D) DNA cut with Hindlll 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp A A DNA 10,000 20,000 30,000 40,000 48,502 (bp)arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License