Which of these statements is true about the elongation step of translation?The growing polypeptide chain is transferred from the P site RNA to the A site RNAOThe MRNA moves through the ribosomeOThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P siteThe small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide

The central dogma of molecular biology elucidates the sequential transfer of genetic information,…

Which of these statements is true about the elongation step of translation? O The growing polypeptide chain is transferred from the P site (RNA to the A site TRNA The MRNA moves through the ribosome The new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide

Which of these statements is true about the elongation step of translation? O The growing polypeptide chain is transferred from the P site (RNA to the A site TRNA The MRNA moves through the ribosome The new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA The MRNA moves through the ribosome The new amino acid is transferred from the A site RNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct tRNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxxYgen from water to the carboxyl group of the peptidyl-tRNA in the P site, causing stalling O Starvation for amino acids will reduce the amount of amino-acylated (charged) tRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon
Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct ERNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxygen from water to the carboxyl group of the peptidyl- RNA in the P site, causing stalling. O Starvation for amino acids will reduce the amount of amino-acylated (charged) TRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
Which statement about nonsense mediated decay (NMD) is false? O detects MRNAS containing premature termination codons and degrades them depends on the presence of exon junction complex (EJC) attached next to splice sites O It occurs during the first (“pioneer") round of translation O it is triggered by the ribosome-TRNA complex
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunit interferes with the normal pairing of aminoacyl TRNAS and codons resulting in abnormal proteins prevents the release of the initiator tRNA from the P site, blocking elongation blocks termination by competitively inhibiting the binding of a release factor to the A site
A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'- AUGAAAAAAAAAAAAUAA-3' has the following effect: the only product made is a Met-Lys dipeptide that remains attached to the ribosome. What is the most likely way in which the poison acts to inhibit protein synthesis? It mimics a methionine tRNA. O It inhibits stop proteins from entering the ribosome O It inhibits movement of translocation so it can't empty the P-site O It inhibits the P site from accepting a tRNA to begin with
identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAifMet
Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately positioned in a ribosome at the initiation of translation? O binding between the mRNA Shine-Dalgarno sequence and ribosomal proteins base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the small ribosomal subunit O binding between ribosomal proteins and the initiation factor that base-pairs with the start codon O base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the large ribosomal subunit