Which of the following statements about protein elongation are correct? I. There is a nucleophilic attack from the amino group in the P site to the carbonyl in the A site. II. Each peptide bond requires the hydrolysis of -2 GTP molecules. III. The ribosome moves one codon at a time towards the 3'-end of the mRNA. IV. EF-Tu also plays a part in ensuring translation fidelity.

Which of the following statements about protein elongation are correct? I. There is a nucleophilic attack from the amino group in the P site to the carbonyl in the A site. II. Each peptide bond requires the hydrolysis of -2 GTP molecules. III. The ribosome moves one codon at a time towards the 3'-end of the mRNA. IV. EF-Tu also plays a part in ensuring translation fidelity.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

During the termination of translation, what is the correct polypeptide sequence which will be released by the ribosome? 5' - AUG - UAU - CUC - UUU - 3' (mRNA codon sequence) 3' - UAC - AUA - GAG - AAA - 5' (tRNA anticodon sequence) A.START - Tyr - Leu - Phe B. Tyr - Ile - Glu - Lys C. START - Ile - Glu - Lys D. Ser - Tyr - Gly - Cys
1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
Which of the following statements concerning translation is NOT correct? O b. O c. Polypeptide chain is extended from the C- terminus to the N-terminus. O d. The first codon of protein synthesis is AUG. Prokaryotic transcription and translation are coupled (i.e. they occur almost at the same time and at the same place). O e. Protein synthesis takes place in ribosome. During protein synthesis, the mRNA is read from 5' to 3' direction.
The following segment of mRNA encodes an interstitial segment of a polypeptide (thedifferent codons appear separately): 5'... AAU CUA UUC AUU AAA ACC ... 3'a) Determine the sequence of the two strands of the DNA fragment from which this RNA comes. highlighting the sense and antisense strandb) What will be the corresponding amino acid sequence that originates in the translation
Below is a diagram of charged tRNAS in the active site of the ribosome during translation of the MRNA into protein. What would be the codon in the mRNA that base pairs with the anti-codon in the t- RNA charged with Glu (Glutamic acid) ? HINT: Check the genetic code table/chart. X. Ala Arg Cys Gly Met Trp Leu Glu TRNA B TRNA A A 5'-AAC-3' 5'-CUU-3' 5'-GAA-3' 5'-AUG-3'
3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
Consider the translation of the following mRNA base sequence below during protein synthesis and identify the following: 5' CAA CGA AAG 3' 1. Codon/s associated with this base sequence 2. tRNA anticodons that are compatible with this base sequence 3. The amino acids specified by this base sequence
Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is attached to the P site B. Amino acids/peptides attached to the amino acyl tRNA at the P site are transferred to amino acids at the A site, followed by translocation. C. Empty TRNAS are immediately released from the ribosomes D. The E site is always empty after translocation to receive incoming empty TRNAS. E. The anticodon binding to the codon is stringent, i.e. there must be complete complementary base-pairing between the bases in the codon and anticodon before translation can proceed.
1. The following is showing the process of translation with MRNA, tRNA and a ribosome. a) Label the 5 and 3' of the tRNA b) Fill in the empty boxes with nucleotides tRNA tRNA c) Fill the shaded boxes with the correct amino acid. 31 А С G GA MRNA 2. A molecule of tRNA with the anticodon 5'-ACC-3' will transport the amino nnid the tDh
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid