During translation, this mutation results in a change from the amino acid aspartic acid to the amino acid alanine. Which of the following determines how the resulting protein will be affected by this mutation? O Any change in amino acid will determine that the polypeptide chain will not be able to fold into its proper structure. O The change in amino acid will determine that a nonsense mutation has occurred and not all amino acids will be added to the polypeptide chain. O The properties of the amino acids will determine whether the interactions within the protein will affect the folding of the polypeptide chain. The substitution of the DNA nucleotide will determine whether there is a change in the folding of the

During translation, this mutation results in a change from the amino acid aspartic acid to the amino acid alanine. Which of the following determines how the resulting protein will be affected by this mutation? O Any change in amino acid will determine that the polypeptide chain will not be able to fold into its proper structure. O The change in amino acid will determine that a nonsense mutation has occurred and not all amino acids will be added to the polypeptide chain. O The properties of the amino acids will determine whether the interactions within the protein will affect the folding of the polypeptide chain. The substitution of the DNA nucleotide will determine whether there is a change in the folding of the

Name: During translation, this mutation results in a change fromthe amino a
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: During translation, this mutation results in a change fromthe amino acid aspartic acid to the amino acid alanine.Which of the following determines how the resultingprotein will be affected by this mutation?O Any change in amino acid will determine t

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Similar questions

On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH₂OH HO OH Н H CH₂OH Н ОН HO HN-C-CH3 о c=0 NHI -NH-C - CH2C-H ОН Н нн ОН НН CH2OH Он OH HO Н NH 1 С=0 -CH2-C-н NH C=0 LO-CH2-C-H NH A В с
Sickle-cell disease is caused by a so-called point mutation in the humanβ - globin gene. A point mutation is the result of a single base substitution inthe DNA encoding a gene. The sickle-cell mutation results in the substitutionof Val for Glu at position 6 in the β - globin protein.(a) Using the information in as shown, explain how a point mutationcould change a codon for Glu to a codon for Val.(b) Do you expect the pI for the sickle-cell β - globin to be higher or lowerthan the pI for wild-type β-globin ? Explain.
Sickle-cell disease is caused by a so-called point mutation in the humanβ-globin gene. A point mutation is the result of a single base substitution inthe DNA encoding a gene. The sickle-cell mutation results in the substitution of Val for Glu at position 6 in the β-globin protein.(a) Using the information in Figure, explain how a point mutationcould change a codon for Glu to a codon for Val.(b) Do you expect the pI for the sickle-cell b-globin to be higher or lowerthan the pI for wild-type β-globin? Explain
In prokaryotic protein synthesis, Nformylmethionine (fmet) is the first amino acid incorporated, whereas(normal) methionine is incorporated in eukaryotes. The same codon(AUG) serves both. What prevents methionine from being insertedinto the beginning and N-formylmethionine in the interior?
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
One single polypeptide chain (120 amino acid residues) is produced for protein A in prokaryotic cell. N-terminal amino acid is alanine in the chain of this protein. How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What post-translational modifications may be for this protein?
Many blood clotting proteins undergo a post-translational modification in which specific glutamic acid residues (Glu) in the protein are converted to gamma-carboxyglutamic acid residues (Gla). See reaction scheme below. An example is the blood clotting protein Factor IX, which has 12 Glu in its N-terminus converted to Gla. This modification gives Factor IX the ability to bind calcium and phospholipid membranes. Bacteria do not have the enzyme required to convert Glu to Gla and therefore Factor IX proteins expressed in bacteria would not have the proper modifications. How might you engineer the translational apparatus of a bacterial cell line so that it produces Factor IX with Gla in the appropriate positions. How would you ensure that only the 12 Glu in Factor IX that are normally converted to Gla and not just all Glu (Limit 5-6 senetnces)?
The synthesis of a peptide is given by the mRNA sequence 5'GAAGAGAAACUUACU3', Find the primary structure of this peptide. If, due to a transcription error, the fourth, eighth, and ninth nucleotides are omitted, what peptide would be synthesized? Find the charge of each peptide at pH7 and explain whether this transcription error can affect the biological activity of said molecule.
Which of the following cannot be said regarding aminoacyl tRNA synthetase? It is essential for the correct reading of codons. A single tRNA synthetase can attach different amino acids to their corresponding tRNA. It is first activated when it catalyzes a reaction between ATP and an amino acid to form an aminoacyladenylic acid (amino acyl-AMP). It is responsible for the attachment of the correct amino acid to the correct tRNA. There is a different tRNA synthetase for each amino acid that will be attached to a tRNA.
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
ADP ribosylation is one example of post-translational modification of an enzyme. Which statements about the process is true? ADP ribosylation will affect protein folding because of the addition of a large molecule ADP ribose can be added to the amine group of lysine or glutamine The ending of DNA around histones in the nucleus is altered by the ADP -ribosylation of the histone proteins in cancer cells ADP ribosylation requires ADP and the target protein as the substrates in the ADP ribosylation ADP ribosylation of phosphoinositol is an important step in signaling through a G protein-coupled receptor pathway.