Which statement about nonsense mediated decay (NMD) is false?detects MRNAS containing premature termination codons and degrades themdepends on the presence of exon junction complex (EJC) attached next to splicesitesIt occurs during the first (“pioneer") round of translationit is triggered by the ribosome- RNA complex The figure depicts what kind of splicing:A sequence change (asterisk) has abolished the acceptor site at the 3' end ofintron 1. Exon 2 is skippedA sequence change has abolished the acceptor site at the normal end of intron 2.Instead of skipping exon 3, the spliceosome has found a nearby alternativeacceptor-like sequence, a' in intron 2, to use.the three exons are spliced as processed normallyA sequence change has activated a cryptic acceptor site, a’ in intron 2. Adownstream sequence d' is used as a new donor site, creating a novel extraexon.

Name: Which statement about nonsense mediated decay (NMD) is false?detects
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which statement about nonsense mediated decay (NMD) is false?detects MRNAS containing premature termination codons and degrades themdepends on the presence of exon junction complex (EJC) attached next to splicesitesIt occurs during the first (“pione

"Since you have asked multiple questions, we will solve the first question for you. if you want any…

Science

Biology

Which statement about nonsense mediated decay (NMD) is false? detects mRNAs containing premature termination codons and degrades them depends on the presence of exon junction complex (EJC) attached next to splice sites O It occurs during the first (“pioneer") round of translation it is triggered by the ribosome-tRNA complex

Which statement about nonsense mediated decay (NMD) is false? detects mRNAs containing premature termination codons and degrades them depends on the presence of exon junction complex (EJC) attached next to splice sites O It occurs during the first (“pioneer") round of translation it is triggered by the ribosome-tRNA complex

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, Glycine
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. If the same experiment had been conducted on bacterial cells, what results would you expect?
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning.
Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…