A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA: Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG - Which is the transcribed (template) strand?  Write the sequence of the resulting mRNA transcript.  Add labels to the strands above to show the 3’ and 5’ ends.

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…

A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: Pre-mRNA or precursor mRNA is a type of primary transcript, which becomes the matured messenger RNA…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes…

A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…

Q: There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What…

A: Threonine is a type of amino acid. Amino acids are the building block of proteins. These are…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: What basal transcription factor unwinds the DNA during transcription initiation? Aside from…

A: Basal transcription factor is that protein which bind to a DNA sequence which helps in initiation of…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU nonsense Refer to…

A: Genetic codes are genetic information present in the nucleotide sequences of mRNA (messenger RNA)…

Q: Given this mRNA strand: 3’ -   AUGAGGAAGGUA   - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: This question pertains to membrane transport and cell signaling.  What are kinases and phosphatases?…

A: Cell signaling pathway is an important biological process that involves as a series of reactions.…

Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…

A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Introduction Transcription is a process by which mRNA is produce from DNA. Once the mRNA is formed…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: All of the following are needed for capping of eukaryotic mRNA, EXCEPT   Question 27 options:…

A: Eukaryotic mRNA is a single-stranded ribonucleic acid. This is associated with the protein…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction  Gene expression is the process through which a gene's information is utilised in the…

Q: Referring to the genetic code presented in Figure , give the aminoacids specified by the following…

A: AUG is the start codon. So, protein synthesis will be start from AUG. So, the coding frame will be…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: The following DNA sequence is found on a chromosome in rice plants:               5’…

A: Given DNA sequence:  5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using…

A: Gene expression is the process through which the genetic codes of a gene, the nucleotide sequence,…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a…

A: DNA => Transcription => mRNA => Translation => Protein Protein synthesis is ribosome…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.