identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA?
Q: Match the following: V(Choose The codon on the MRNA The amino acid which is encoded by the…
A: Introduction Amino acids are molecules that combine to form proteins, these are are the building…
Q: Which of the following events would NOT result in ribosomes stalling on an MRNA during translation?…
A: A release factor is a protein that recognizes a stop codon in an mRNA sequence and causes…
Q: What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)?…
A: EF-Tu is a highly conserved elongation factor in prokaryotes. It catalyzes the binding of tRNA…
Q: During translation, the growing peptide chain resides in the P site of FRNA with the next amino acid…
A: Answer: CENTRAL DOGMA = This is the basic mechanism by which DNA is replicate and transcript in the…
Q: Which of these statements is true about the elongation step of translation? O The growing…
A: Translation is the process by which the triplet base sequence of an mRNA guides the linking of a…
Q: Which of the following statements about translation is false? In eukaryotes, the 5' cap and…
A: In molecular biology, the process by which the gene information in the DNA gets converted into a…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: RNA splicing is the process of removal of non coding sequences called as introns and joining of…
Q: Prokaryotic cells can have more than one functional start codon per mRNA because There are…
A: It is a multiple choice question
Q: Describe the various post-transcriptional and post-translational modifications that occur during the…
A: Post-transcriptional modifications are those modifications that occur after the completion of…
Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: Which of the following statements about RNA structure is FALSE? O A. A sequence in a tRNA that forms…
A: A transfer RNA is an adaptor molecule that is composed of RNA and serves as the physical link…
Q: Provide the correct sequence of steps in each process described below. Write the letters in series…
A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What…
A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: Match each protein/factor to the role it plays 30S subunit [ Choose ] 50S subunit [ Choose ] IF-1…
A: Initiation factors (IF) are proteins that bind to the smaller ribosomal subunit that helps to…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: In science, a gene is an essential unit of heredity and a succession of nucleotides in DNA or RNA…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…
Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…
A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: Use the numbers below to indicate the correct order of events (from left to right) during the…
A: Hi, Thanks For Your Question. Answer : Correct Sequence Is 3 4 2 1 5.
Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…
A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…
Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…
A: Codon is a triplet of nucleotide base pairs.
Q: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY…
A: DNA to RNA is transcription and RNA to protein is a translation
Q: an anticodon on one end and a site for an amino acid to attach on the other end. There is base…
A: Translation :- It is the process by which a protein is synthesized from the information contained…
Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…
A: Translation Translation involves the answer of information in mrna molecules into the amino acid…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Ribosomes are the protein synthesizing machinery present in a cell. A protein is synthesized during…
Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?
A: Codons are situated in on mRNA and anticodons are situated on tRNA.
Q: Translation of mRNA is terminated at the stop codon by: A. binding of the Release Factor to stop…
A: The translation is the process, in which the new growing polypeptide chain is synthesized.
Q: In addition to variable sites, the strucutre of a tRNA includes
A: tRNA tRNA or transfer RNA, sometimes referred as sRNA, is a adapter molecule which read the codon…
Q: The steps required for peptide elongation at the ribosome are, respectively, (A) initiation,…
A: The step of the protein biosynthetic pathway involved in the development of nascent polypeptide…
Q: Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs…
A: The 5'-G caping is only found in the eukaryotic mRNA. This is the result of post transcriptional…
Q: The peptidyltransferase reaction begins with the hydrolysis or breaking of the bond between the…
A: Protein molecule is the functional unit of a cell. The information for the synthesis of a protein is…
Q: What is the order of the tRNA binding sites on the 70S ribosome with respect to the 5' 3' direction…
A: Each ribosomal subunit has three binding sites for tRNA: the A (aminoacyl) site, which accepts the…
Q: After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized,…
A: Translation is a process of protein synthesis. It is completed in three steps- Initiation…
Q: The following segment of DNA codes for a protein. The uppercase letters represent exons. The…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…
Q: Initiation of prokaryotic translation begins when the: A. large and small ribosomal subunits link…
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: Renata enzymatically conjugates a l"C-labeled cysteine to a transfer RNA (TRNA), with a UGU…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: Do the following events during bacterial translation occur primarily within the 30S subunit, within…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: The tertiary structure of a tRNA is shown below. Using the various colored areas (i.e., red, yellow,…
A: Translation refers to the process of polymerisation of amino acid to form a polypeptide.the order…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…
Q: eliminating the intron RNA immediately after it is excised from the pre-mRNA?
A: As we know that, the process of removing the introns and rejoining the coding section or exons ,of…
Q: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY…
A: DNA is transcribed into mRNA, mRNA then translated into proteins or peptides. In translation,…
Q: If the amino acid serine attaches to a tRNA, which of the following anticodons could be at the…
A: tRNA tRNA or transfer RNA is a Kind of RNA molecule that decode the code of mRNA and brings amino…
Q: A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate…
A: The central dogma depicts the replication of DNA, the transcription of DNA into RNA, and the…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…
Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…
A: The mRNA is produced from DNA by the process of transcriptions. The initiation of DNA transcription…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: The start codon is the first codon of an mRNA (messenger RNA ) transcript translated by a ribosome.…
identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA?
Here is the mRNA sequence:
5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
- Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letterEF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit of the ribosome to disassociate with the small subunit of the ribosome Bind to the vacant A-site subsequent to peptide bond formation and resolve the hybrid state of the ribosome To recruit the signal recognition particle (SRP) to the ribosome and to facilitate synthesis of membrane proteins O To cause the large subunit to associate with the small subunit of the ribosome Shuttle an amino-acylated tRNA to the A site to initiate the peptidyl transfer reactionGive the single letter translation for the protein encoded by this mRNA. Start with the start codon. 5' M7GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGAAAA O ATDHXPTK OPTYMATDH MRAHVT O MATDH AAAAAA - 3'
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop