How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunit interferes with the normal pairing of aminoacyl TRNAS and codons resulting in abnormal proteins prevents the release of the initiator tRNA from the P site, blocking elongation blocks termination by competitively inhibiting the binding of a release factor to the A site

How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunit interferes with the normal pairing of aminoacyl TRNAS and codons resulting in abnormal proteins prevents the release of the initiator tRNA from the P site, blocking elongation blocks termination by competitively inhibiting the binding of a release factor to the A site

Name: How does the antibiotic streptomycin inhibit bacterial translation?Mu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: How does the antibiotic streptomycin inhibit bacterial translation?Multiple Choiceblocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunitinterferes with the normal pairing of aminoacyl TRNAS and codons

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'
Drag the functions involved in the bacterial translation process into the appropriate box with the corresponding name of the translation factor or component. Reset Help Prevents premature association of the large ribosomal subunit with the small Serves as the MRNA binding site for Guides the initiator fMet-tRNA into the the small ribosomal subunit. P site. ribosomal subunit. Prevents entry of an amino-acyl tRNA into the ribosome A site during the early initiation stages. Assists incoming amino-acyl RNA into the A site. IF1 IF2 IF3 EF-Tu Shine-Dalgarno sequence
Determine whether each event occurs during initiation, elongation, or termination. Initiation Peptidyl transferase transfers the peptidyl group to water. In E. coli, EF-Tu hydrolyzes GTP. Elongation In E. coli, mRNA binds to the 30S ribosomal subunit. Answer Bank In prokaryotes, the Shine-Dalgarno sequence pairs with rRNA. In E. coli, EF-Tu delivers an aminoacyl-tRNA to the ribosome. Termination Translocation occurs. Initiator tRNA enters the P site.
Determine whether each event occurs during initiation, elongation, or termination. Initiation Initiator tRNA enters the P site. Elongation Answer Bank In E. coli, EF-Tu delivers an aminoacyl-tRNA to the ribosome. In prokaryotes, the Shine-Dalgarno sequence pairs with rRNA. The ribosome has mRNA, an empty A site, and a deacylated tRNA in the P site. IF2 dissociates. In E. coli, EF-Tu hydrolyzes GTP. Termination Translocation occurs.
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAi fMet
Arrange the processes involved from Transcription to Translation. RNA polymerase binds in the promoter regions Polypeptide cleavage Release of methionine and conversion to active protein Translocation Appearance of UAG codon Attachment of the mRNA to ribosome with AUG in the P site DNA rejoins Covalent bonding of AA to the tRNA Elongation of RNA transcript Binding of Rho factor Partial unwinding of DNA
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
The tRNA molecule carries EIF2 and GTP and binds the small ribosomal subunit at the P site in the first steps of translation initiation. tue or false
Prokaryotic cells can have more than one functional start codon per mRNA because There are multiple answers A prokaryotic promotes consist of two separated sequences: the -30 box and the -10 box B they make polycistronic RNA C both transcription and translation happen in the same cellular compartment D prokaryotic ribosomes bind to the Shine-Delgarno sequence E the activity of the lac repressor is regulated based on the physiologic condition of the cell
Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase