Match the given step with the major central dogma event being referred to. An enzyme covalently adds a 7-methyl guanosine triphosphate to the 5'end of a pre-MRNA. O translation elongation O transcription initiation O splicing: 1st transesterification reaction O splicing: 2nd transesterification reaction O tailing O transcription termination O transcription elongation О саpping- O translation initation O translation termination

Match the given step with the major central dogma event being referred to. An enzyme covalently adds a 7-methyl guanosine triphosphate to the 5'end of a pre-MRNA. O translation elongation O transcription initiation O splicing: 1st transesterification reaction O splicing: 2nd transesterification reaction O tailing O transcription termination O transcription elongation О саpping- O translation initation O translation termination

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor enters the A site release factor enters the P site O the MRNA forms a loop structure that blocks further ribosomal function O OO 0
Part A Which of the following processes is represented in the figure below? A 5' ÀÚGÚÚČĞĞŮ 3' AAG UGA UUC RF1 RF2 transcription initiation translation initiation translation elongation transcription elongation translation termination O O O
Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct tRNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxxYgen from water to the carboxyl group of the peptidyl-tRNA in the P site, causing stalling O Starvation for amino acids will reduce the amount of amino-acylated (charged) tRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon
Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct ERNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxygen from water to the carboxyl group of the peptidyl- RNA in the P site, causing stalling. O Starvation for amino acids will reduce the amount of amino-acylated (charged) TRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Which of the following is unique to eukaryotic mRNA synthesis? O Coupled transcription-translation O Polycistronic mRNA Removal of introns O Polysomes
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA The MRNA moves through the ribosome The new amino acid is transferred from the A site RNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor enters the A site release factor enters the P site O the MRNA forms a loop structure that blocks further ribosomal function
Indicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in termination
If the sequence of the coding strand in a transcription unit is writtenas follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of mRNA