BONUS: In Bacteria,recognizes the Ribosomal Binding site on mRNA andcatalyzes formation of peptide bonds during translation (answers must be in correct order)O aminoacyl tRNAses; aminoacyl TRNA synthetasesribosomal protein translation factors; ribosomal protein initiation factorsO helicase; gyraseO 165 rRNA; 23S rRNA

Name: BONUS: In Bacteria,recognizes the Ribosomal Binding site on mRNA andc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: BONUS: In Bacteria,recognizes the Ribosomal Binding site on mRNA andcatalyzes formation of peptide bonds during translation (answers must be in correct order)O aminoacyl tRNAses; aminoacyl TRNA synthetasesribosomal protein translation factors; ribos

RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…

Science

Biology

BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in correct order) recognizes the Ribosomal Binding site on MRNA and aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase 16S rRNA; 23S RNA

BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in correct order) recognizes the Ribosomal Binding site on MRNA and aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase 16S rRNA; 23S RNA

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Similar questions

10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
es/2015347/quizzes/5825805/take The "factory" itself, made of two [Choose] subunits [Choose ] FRNA The site from which the growing polypeptide chain exits the ribosome RELEASE FACTOR CODON RIBOSOME P SITE The processed copy of DNA that UGA carries its sequence of codons to the TRNA ribosome AUG ANTICODON MRNA The carriers of each unique amino acid E-SITE to A-site of the ribosome The three letter message carried to [ Choose ] the ribosome on the "toes" of the TRNA The site from which the now empty [ Choose ] TRNA leaves the ribosome The first codon required to initiate [ Choose ] translation (on the mRNA). The binding chemical that comes along once the STOP codon is encountered: disassembles the ribosomal complex [Choosc] hp
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
Direction: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…
Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit
identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'
Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located