FMet pro UAC GGG AUGCCCACG UAG MRNA

Q: Which of the following statements about translation is false?     In eukaryotes, the 5' cap and…

A: In molecular biology, the process by which the gene information in the DNA gets converted into a…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…

Q: Explain the functional roles of the A, P, and E sites during translation.

A: In molecular biology, translation is a process in which ribosomes in the cytoplasm or endoplasmic…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Describe in detail the steps of translation termination in bacteria. Explain what happe

A: For the synthesis of a polypeptide with a defined sequence, two fundamental chemical requirements…

Q: Which of the following best describes a sequence of events that happens during the elongation phase…

A: The translation is a process by which protein is synthesized using mRNA as a template. This process…

Q: Explain where the energy comes from for the peptide bond formation during translation

A: The translation is the biochemical process of the synthesis of the polypeptide chain of amino acid…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…

A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…

Q: A portion of prokaryotic mRNA has the following base sequence: 5'ACAUCUAUGCCACGA3'. Which of the…

A: The given m RNA sequance will help in synthesis of the protien by the process of Translation .

Q: During translation, amino acid chain termination requires

A: Translation is the biological process of converting the mRNA sequence to a sequence of amino acids.…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: The process of translation involves three distinct phases: initiation, elongation, and termination.…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: Describe what is happening at each of the four stages of translation shown in the above diagram-

A: The translation is a process by which the genetic code contained within a messenger RNA molecule is…

Q: 5’      UUGCAUUGCAGC    3’    Write out ALL of the possible reading frames for the RNA shown in…

A: The DNA acts as the genetic material of a living organism. This DNA generally gets replicates to…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

A:

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…

A:

Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG

A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: During initiation of translation, a                                  is positioned first at the…

A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…

Q: As opposed to DNA replication or transcription, translation requires the correct reading frame.…

A: A double-stranded DNA molecule can read in any of six possible reading frames- three in the forward…

Q: Describe some of the ways that the initiation step of translation differs from the elongation steps…

A: The principle of protein folding substantiates that all the data needed for a protein to correctly…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A:

Q: In the elongation stage of translation, which of the following options is correct? the polypeptide…

A: The Central Dogma of molecular biology refers to the flow of information from DNA to RNA to…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: what is the genetic code and explain the properties

A: Hi! Thanks for your question. But as you have posted multiple subpart questions, I am answering the…

Q: Which of these statements is true about the elongation step of translation? O The growing…

A: ANSWER;- The small ribosomal subunit detaches and reattaches every time a new amino acid is…

Q: Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is…

A: The translation is the process by which amino acids chain or polypeptide chain is produced from the…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: Formation of the 70S ribosomal initiation complex for prokaryotic translation requires: a.tRNAfMet…

A: Translation is the process of synthesis of protein. In prokaryotes, it occurs in cytosol, large and…

Q: Translation ends when the ribosome reaches           .   A. A termination sequence   B. A stop…

A: Translation is a process of formation of proteins from mRNA. This process is catalysed by ribosomes.…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…

A: The translation is the biological process that involves the conversion of the genetic information in…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…

Q: The codon and anticodon are base-paired together during the process of translation. Which of the…

A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…

Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…

A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…

Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…

A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…

Q: Translation is the process by which the sets of 3 bases (codons) of the MRNA are read to specify the…

A: The translation is a process through which the mRNA gets translated into polypeptide chains. The…

Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…

A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…

Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…

A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: The following sequence is from the template strand of a bacterial gene, and it includes the…

A: According to the central dogma of the molecular theory, the information stored in DNA is first…

Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…

A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.