Concept explainers
To review:
The protocol for studying and contrasting the structure of DNA (deoxyribonucleic acid) isolated from two new strains of viruses.
Introduction:
DNA samples are isolated to analyze the genome structure of organisms and the similarity level they have from the other species. Defined protocol is followed in which sequencing of the genome remains the first step such that to obtain the genome sequence of an organism, which can be subjected to similarity check among other organisms. DNA extraction is the process carried out by following standardized protocol corresponding to the sample from which DNA is being isolated as in this case the subject sample is viruses. The stable integrated DNA obtained is used forvarious applications like studying structural characteristic, genetic experiments, hereditaryresemblance and carrying medicinal diagnostics.
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
Essentials of Genetics (9th Edition) - Standalone book
- Discuss the principles behind the use of the following techniques in the diagnosis of viral infections, providing examples of viruses diagnosed using these methods 5..1 ELISA 5.2 Restriction Fragment Length Polymorphism 5.3 Polymerase chain reactionarrow_forwardChoose one product of recominbinant DNA technology and write the steps involved in the production of the modified organism. I chose Flavr Savr Tomato. However, I can't find the steps involved for this. Thank you for your help. Ps. Please make it simple and easy to understand. If you can give me a simplified version of a certain source. That will be a big help :)arrow_forwardDiscuss the principles behind the use of the following techniques in the diagnosis of viral infections, providing examples of viruses diagnosed using these methods: Restriction Fragment Length Polymorphismarrow_forward
- After giving brief information about the viruses, discuss briefly what is meant by their virulent effects on their hosts and in which two ways this effect occurs. Comment and illustrate the use of viruses within the scope of Recombinant DNA Technology.arrow_forwardThe idea behind PCR-based diagnostics is that a very small number of microbial genomes in a patient sample can be multiplied by PCR and more easily detected by the clinical team managing the patient’s care. Also, genetic-based diagnostics are very useful for viral infections because we don’t have biochemical tests, etc. to distinguish one virus from another (remember, viruses are metabolically inactive). However, a lot of work goes into the development of these tests. For instance, PCR requires primers that are complementary to the viral genome that is being copied. If primers are complementary to the target genome, what must scientists know to design primers that bind to the viral genome to be copied? (I mean this to be a general question; don’t look up the details of designing primers)arrow_forwardPlease answer these two questions regarding PCR: a) Why do you need to perform PCR on DNA obtained from a crime scene? b) Why so forensic labs analyze non-coding DNA rather than genes?arrow_forward
- A MLS supervisor is writing an Standard Operating Procedure (SOP) for running a PC test for Hepatitis B DNA. There are several things she must include in the instructions to run the test.1. On average, how many PCR cycles must be run to see if the test is positive or negative for HBV?2. What would a positive test and a negative test look like?3. Her younger sister wants to know what she did at work today. How should she explain what happens during each step of the PCR cycle.arrow_forwardThe question is: A patient has arrived at the doctor complaining of acute respiratory symptoms (cough, runny nose, fever). The patient explains to the doctor that he was at a concert the night before and shared a water bottle with a friend who had similar symptoms. The doctor tells the patient that he has a virus. a.) What form of replication do you think this virus does use? How do you know? b.) Can the doctor prescribe an antibiotic for this patient? Explain.arrow_forwardThe table below shows the properties of the genomes of three different viruses. The data were obtained as follows: Nuclease sensitivity was measured by the ability of deoxyribonuclease (DNase) or ribonuclease (RNase) to destroy the genome (a “+" means sensitivity). The ability of the genome to act as mRNA was tested by incubating it in a cell-free system. If amino acids were incorporated into protein, the data are shown as a Finally, the virus particles were tested for the presence of a virion polymerase. If an enzyme was present, the data show whether it could polymerize deoxynucleotide triphosphates (DNTPS) or nucleoside triphosphates (NTPS). "+. Genome Properties Nuclease Virion Can Genome Sensitivity? Polymerase? Be an mRNA? Virus DNase RNase With With DNTPS NTPS #1 - - #2 - - #3 For each virus, indicate the strategy of the genome, using the Baltimore classification. What is the nature of the product of the virion polymerase when present? + + + + + +arrow_forward
- NOTE: explain in a paragraph form How does PCR help in the identification of the virus from patients?arrow_forwardA urine sample has been obtained, and the bacteria in this sample were cultured. To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format): > sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG…arrow_forwardExplain how PCR/OLA (polymerase chain reaction/oligonucleotide ligation assay) can be used in the diagnosis of sickle cell disorder . Would you recommend this method for routine diagnosis of sickle cell disorder? Explainarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education