Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 28PDQ
One of the most common spontaneous lesions that occurs in DNA under physiological conditions is the hydrolysis of the amino group of cytosine, converting it to uracil. What would be the effect on DNA structure if a uracil group replaced cytosine?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
Which type of information about the nucleotide sequenceof the target DNA is required ?
The double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?
Chapter 9 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 9 - CASE STUDY |Zigs and zags of the smallpox virus...Ch. 9 -
CASE STUDY | Zigs and zags of the smallpox...Ch. 9 - CASE STUDY | Zigs and zags of the smallpox...Ch. 9 - CASE STUDY | Zigs and zags of the smallpox virus...Ch. 9 -
HOW DO WE KNOW?
1. In this chapter, we have...Ch. 9 - Review the Chapter Concepts list on p. 160. Most...Ch. 9 - Discuss the reasons why proteins were generally...Ch. 9 -
4. Contrast the various contributions made to our...Ch. 9 - When Avery and his colleagues had obtained what...Ch. 9 - Why were 32P and 35S chosen in the Hershey–Chase...
Ch. 9 - Does the design of the Hershey-Chase experiment...Ch. 9 - What observations are consistent with the...Ch. 9 - What are the exceptions to the general rule that...Ch. 9 -
10. Draw the chemical structure of the three...Ch. 9 - How are the carbon and nitrogen atoms of the...Ch. 9 - Adenine may also be named 6–amino purine. How...Ch. 9 -
13. Draw the chemical structure of a dinucleotide...Ch. 9 - Describe the various characteristics of the...Ch. 9 - Prob. 15PDQCh. 9 - What might Watson and Crick have concluded, had...Ch. 9 - Prob. 17PDQCh. 9 - Prob. 18PDQCh. 9 - Prob. 19PDQCh. 9 - Prob. 20PDQCh. 9 - Prob. 21PDQCh. 9 - Prob. 22PDQCh. 9 -
23. Why is Tm related to base composition?
Ch. 9 - What is the chemical basis of molecular...Ch. 9 - What did the Watson–Crick model suggest about the...Ch. 9 - A genetics student was asked to draw the chemical...Ch. 9 - Prob. 27PDQCh. 9 -
28. One of the most common spontaneous lesions...Ch. 9 - Prob. 29PDQCh. 9 - Prob. 30PDQCh. 9 - Prob. 31PDQCh. 9 -
32. During electrophoresis, DNA molecules can...Ch. 9 - Assume that you are interested in separating short...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardHow important and useful to the cell is the ability of the DNA to assume various forms? Why are these various forms necessary?arrow_forwardHydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. H₂N HN N O™ -O-P-O-CH₂ Guanine H₂N N HN Select the chemical consequences that could contribute to DNA instability at AP sites. H H 1₂0/ H fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base H H Guanosine residue (in DNA) O™ -O-P-O-CH₂ O H H H O Apurinic residue H OH Harrow_forward
- A spontaneous deamination of cytosine to uracil in DNA occurs at a rate about 100 bases per cell per day. Explain the DNA repair mechanistic steps that can remove uracil and repair the DNA break.arrow_forwardIf the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forwardConsider a three-base sequence in the template of DNA: 5' . . . 123 . . .3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides.Comment on the probable effect on the resulting protein if the following point mutations (one-base substitutions) occurred.(a) changing one purine for another in position 1(b) changing one pyrimidine for another in position 2(c) changing a purine to a pyrimidine in position 2(d) changing one purine for another in position 3arrow_forward
- In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardWhy is a methylated base employed in DNA and not in RNA?arrow_forward
- 2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]arrow_forwardDNA is damaged when a base from the DNA chain is removed after an alkylation has occurred. In a depurination reaction, the purine nitrogenous base is displaced from its sugar as shown in this reaction. Draw the mechanism for this reaction and suggest a reason why it occurs so easily. HN' P H2N .N H,O HN° + Pi ОН N- H2N° ОН ОН ОН ОНarrow_forwardWhat are the products obtained from hydrolysis of DNA by an acid?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license